Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17406
Trapped Gene
Rwdd2b (ENSMUSG00000041079)
Vector Insertion
Chr 16: 87437760 - 87440681
Public Clones 5SE289C02 (ggtc) D173C06 (ggtc) D173C06 (ggtc) CMHD-GT_465H5-3 (cmhd) IST10876H1 (tigm)
IST12511C8 (tigm) IST14178F9 (tigm)
Private Clones OST443372 (lexicon) OST437081 (lexicon) OST333758 (lexicon) OST309661 (lexicon)
OST249798 (lexicon) OST194850 (lexicon) OST96484 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000471614 (Chr16:87440682..87440837 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCTCTGGGGTGAGACCTG Chr16:87440737..87440756 60.39 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000471614 (Chr16:87440682..87440837 -)
Downstram Exon
ENSMUSE00000266745 (Chr16:87437539..87437759 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCTCTGGGGTGAGACCTG Chr16:87440737..87440756 60.39 60 AGAGGTCCAGGCTCACATTG Chr16:87437531..87437550 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471614 Chr16:87440682..87440837 TCTCTCTGGGGTGAGACCTG Chr16:87440737..87440756 60.39 60

*** Putative Vector Insertion (Chr 16: 87437760 - 87440681) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000266745 Chr16:87437539..87437759 AGAGGTCCAGGCTCACATTG Chr16:87437531..87437550 60.26 55
downstream ENSMUSE00000266735 Chr16:87437309..87437376 CTGTAATTTCGGGCAGGACT Chr16:87437291..87437310 59.19 50
downstream ENSMUSE00000266722 Chr16:87436818..87437180 GTGAAAGCGAGATCCTCTGG Chr16:87436958..87436977 59.95 55
downstream ENSMUSE00000443798 Chr16:87433576..87434871 CAGTGAGCCAACAGGTCTGA Chr16:87434579..87434598 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTTCTAATCGCCTTGCAG Chr16:87440616..87440636 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCTTAATCGCCTTGCAG Chr16:87437773..87437793 58.27 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 ACGTGAACGCTAAGCAAGAA Chr16:87437865..87437885 58.73 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041079