Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17408
Trapped Gene
Zmym5 (ENSMUSG00000040123)
Vector Insertion
Chr 14: 57423701 - 57429576
Public Clones IST15111C10 (tigm) IST14725G3 (tigm)
Private Clones OST443367 (lexicon) OST303057 (lexicon) OST178347 (lexicon) OST134201 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000687343 (Chr14:57429577..57429696 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGACGCGTTTACTCTTCG Chr14:57429673..57429692 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000687343 (Chr14:57429577..57429696 -)
Downstram Exon
ENSMUSE00000710707 (Chr14:57423252..57423700 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGACGCGTTTACTCTTCG Chr14:57429673..57429692 60.01 55 TTCGGTCCCCATTCAATAAA Chr14:57423291..57423310 60.12 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000615400 Chr14:57430429..57430534 No primer for this exon
upstream ENSMUSE00000687344 Chr14:57430171..57430301 No primer for this exon
upstream ENSMUSE00000687343 Chr14:57429577..57429696 GAGGACGCGTTTACTCTTCG Chr14:57429673..57429692 60.01 55

*** Putative Vector Insertion (Chr 14: 57423701 - 57429576) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000710707 Chr14:57423252..57423700 TTCGGTCCCCATTCAATAAA Chr14:57423291..57423310 60.12 40
downstream ENSMUSE00000718135 Chr14:57423252..57423700 TTCGGTCCCCATTCAATAAA Chr14:57423291..57423310 60.12 40
downstream ENSMUSE00000496219 Chr14:57422986..57423076 CATCCGTGACATCGATCCTA Chr14:57423003..57423022 59.48 50
downstream ENSMUSE00000687341 Chr14:57422986..57423076 CATCCGTGACATCGATCCTA Chr14:57423003..57423022 59.48 50
downstream ENSMUSE00000309271 Chr14:57417747..57418029 CACCCCTTGTTGTTTCTGGT Chr14:57417952..57417971 59.86 50
downstream ENSMUSE00000687340 Chr14:57417747..57418029 CACCCCTTGTTGTTTCTGGT Chr14:57417952..57417971 59.86 50
downstream ENSMUSE00000309261 Chr14:57416505..57416667 AGGACTTGCTTGACTCCACTG Chr14:57416590..57416610 59.51 52.38
downstream ENSMUSE00000687339 Chr14:57416505..57416667 AGGACTTGCTTGACTCCACTG Chr14:57416590..57416610 59.51 52.38
downstream ENSMUSE00000338684 Chr14:57415441..57415647 AACACTGATTTCATGGCGAAC Chr14:57415605..57415625 59.99 42.86
downstream ENSMUSE00000687338 Chr14:57415441..57415647 AACACTGATTTCATGGCGAAC Chr14:57415605..57415625 59.99 42.86
downstream ENSMUSE00000379913 Chr14:57412165..57413337 CCAATCTTTGCACCCATTCT Chr14:57412734..57412753 59.93 45
downstream ENSMUSE00000687337 Chr14:57411766..57413337 CCAATCTTTGCACCCATTCT Chr14:57412734..57412753 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCCTGCTGTCGTTTAGTT Chr14:57426598..57426618 60.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTCGTGACTGGGAAAAC Chr14:57426510..57426530 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATGGAAGCTTAATCGCCTTG Chr14:57426635..57426655 59.32 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAAGCTCGTGACTGGGAAAA Chr14:57426632..57426652 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040123