Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17412
Trapped Gene
Slc4a11 (ENSMUSG00000074796)
Vector Insertion
Chr 2: 130517815 - 130517901
Public Clones not available
Private Clones OST443317 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683264 (Chr2:130517902..130518066 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACACCGTCAACTCCTCCAT Chr2:130517967..130517986 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683264 (Chr2:130517902..130518066 -)
Downstram Exon
ENSMUSE00000683263 (Chr2:130517765..130517814 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACACCGTCAACTCCTCCAT Chr2:130517967..130517986 59.97 55 ACCCGTTGCAGCTTCTAAGT Chr2:130517773..130517792 59.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683268 Chr2:130523095..130523208 CGAGGATCCAGAACAGACCT Chr2:130523100..130523119 59.25 55
upstream ENSMUSE00000683267 Chr2:130522384..130522491 TACTGCACACCCACTCTACCC Chr2:130522409..130522429 60.04 57.14
upstream ENSMUSE00000683265 Chr2:130521777..130521839 CTGTCAGGACTCCGGTGAAT Chr2:130521786..130521805 60.11 55
upstream ENSMUSE00000683264 Chr2:130517902..130518066 GACACCGTCAACTCCTCCAT Chr2:130517967..130517986 59.97 55

*** Putative Vector Insertion (Chr 2: 130517815 - 130517901) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000683263 Chr2:130517765..130517814 ACCCGTTGCAGCTTCTAAGT Chr2:130517773..130517792 59.01 50
downstream ENSMUSE00000683262 Chr2:130517285..130517516 GGCAAAGCGGTTTAGCATAG Chr2:130517354..130517373 59.88 50
downstream ENSMUSE00000683261 Chr2:130517126..130517207 CAGAGCCAAGACTGCTCGTA Chr2:130517110..130517129 59.34 55
downstream ENSMUSE00000683260 Chr2:130516569..130516692 CAGGATGACAAAGCGAACCT Chr2:130516568..130516587 60.26 50
downstream ENSMUSE00000641067 Chr2:130513690..130513893 TTCCTCTGTGCGAGTCTTCA Chr2:130513773..130513792 59.7 50
downstream ENSMUSE00000683259 Chr2:130513523..130513616 TCCATTGGGTACACAGGAAA Chr2:130513512..130513531 58.82 45
downstream ENSMUSE00000641066 Chr2:130513299..130513424 GACATATTTGCCCACGCTCT Chr2:130513365..130513384 60.1 50
downstream ENSMUSE00000683258 Chr2:130513107..130513220 CGATGCTCTGTCCAGCTATG Chr2:130513166..130513185 59.57 55
downstream ENSMUSE00000641065 Chr2:130512895..130513027 AGAAGGCGTTGAAGTCCAGA Chr2:130512958..130512977 59.99 50
downstream ENSMUSE00000641064 Chr2:130512620..130512693 CAGCACAAACGTGATGGAAA Chr2:130512623..130512642 60.7 45
downstream ENSMUSE00000641063 Chr2:130511767..130512025 CAACATGATGAGGAGGCTGA Chr2:130511789..130511808 59.79 50
downstream ENSMUSE00000641062 Chr2:130511485..130511591 ATAGGAGCCGATGAGGGAGA Chr2:130511482..130511501 61.09 55
downstream ENSMUSE00000641061 Chr2:130511231..130511399 GCTGGGGTTATACCGGAACT Chr2:130511352..130511371 60.21 55
downstream ENSMUSE00000641060 Chr2:130510967..130511140 GACAGCCCCGTATTGATGAT Chr2:130511053..130511072 59.78 50
downstream ENSMUSE00000641059 Chr2:130510594..130510789 AAGAGCCCATACAGCACAGG Chr2:130510645..130510664 60.28 55
downstream ENSMUSE00000641058 Chr2:130510348..130510517 TGATGAGGGGAAAGACCATC Chr2:130510348..130510367 59.86 50
downstream ENSMUSE00000641057 Chr2:130509850..130510239 CCAGCTCATACCTCCCCATA Chr2:130510081..130510100 59.91 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAGAGGGTAATCGCCTTG Chr2:130517839..130517859 59.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000074796