Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17422
Trapped Gene
Numa1 (ENSMUSG00000066306)
Vector Insertion
Chr 7: 109118484 - 109125893
Public Clones (sanger) (sanger) (sanger) P118H10 (ggtc) (ggtc) D136F11 (ggtc)
(ggtc) E053E12 (ggtc) D136F11 (ggtc) (ggtc) E053E12 (ggtc) D043D02 (ggtc)
Private Clones OST443216 (lexicon) OST429939 (lexicon) OST389490 (lexicon) OST388635 (lexicon)
OST380446 (lexicon) OST379467 (lexicon) OST376612 (lexicon) OST350868 (lexicon)
OST345261 (lexicon) OST340605 (lexicon) OST324585 (lexicon) OST298115 (lexicon)
OST291171 (lexicon) OST274729 (lexicon) OST262887 (lexicon) OST262545 (lexicon)
OST257926 (lexicon) OST252558 (lexicon) OST246789 (lexicon) OST236966 (lexicon)
OST232311 (lexicon) OST224689 (lexicon) OST219018 (lexicon) OST216183 (lexicon)
OST215713 (lexicon) OST202176 (lexicon) OST201272 (lexicon) OST192184 (lexicon)
OST191891 (lexicon) OST184148 (lexicon) OST172244 (lexicon) OST168249 (lexicon)
OST139719 (lexicon) OST136447 (lexicon) OST122468 (lexicon) OST114469 (lexicon)
OST112475 (lexicon) OST106953 (lexicon) OST105450 (lexicon) OST104279 (lexicon)
OST92405 (lexicon) OST91359 (lexicon) OST78330 (lexicon) OST61389 (lexicon)
OST56839 (lexicon) OST56160 (lexicon) OST53751 (lexicon) OST46356 (lexicon)
OST45427 (lexicon) OST44786 (lexicon) OST43055 (lexicon) OST41696 (lexicon)
OST35129 (lexicon) OST33833 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000671692 (Chr7:109118357..109118483 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGCTATCGGGACAGAAGA Chr7:109118358..109118377 60.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000671692 (Chr7:109118357..109118483 +)
Downstram Exon
ENSMUSE00000528838 (Chr7:109125894..109125964 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGCTATCGGGACAGAAGA Chr7:109118358..109118377 60.5 55 CCAAGAAAGGAGCGTAGCTG Chr7:109125967..109125986 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000671692 Chr7:109118357..109118483 GCAGCTATCGGGACAGAAGA Chr7:109118358..109118377 60.5 55

*** Putative Vector Insertion (Chr 7: 109118484 - 109125893) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000528838 Chr7:109125894..109125964 CCAAGAAAGGAGCGTAGCTG Chr7:109125967..109125986 60.15 55
downstream ENSMUSE00000633252 Chr7:109136240..109136325 TCAGCAACATGCAGACTGTTC Chr7:109136264..109136284 60.05 47.62
downstream ENSMUSE00000633251 Chr7:109139087..109139166 GCCCCTCTTTAGTGTCATGG Chr7:109139109..109139128 59.55 55
downstream ENSMUSE00000633250 Chr7:109140160..109140242 TTCCATCTCGGATCCCTCTA Chr7:109140236..109140255 59.58 50
downstream ENSMUSE00000633247 Chr7:109141152..109141232 GGAGCTCATGGTGGACTGAT Chr7:109141193..109141212 60.08 55
downstream ENSMUSE00000633245 Chr7:109141739..109141826 TCAGGATGACCGCTAACTCA Chr7:109141763..109141782 59.39 50
downstream ENSMUSE00000633244 Chr7:109143177..109143294 GGAAGCGAATCTTCCTCTTG Chr7:109143257..109143276 59.01 50
downstream ENSMUSE00000633242 Chr7:109143911..109144068 ATCTGGAACTGTGGGGTCTG Chr7:109143976..109143995 59.96 55
downstream ENSMUSE00000633241 Chr7:109144332..109144449 GGAGCTCCTCAAGCTCACTG Chr7:109144436..109144455 60.28 60
downstream ENSMUSE00000633240 Chr7:109144537..109144654 GATCCATCTGGCTCTTCTCG Chr7:109144610..109144629 59.91 55
downstream ENSMUSE00000633239 Chr7:109144949..109145089 TTGAATGCACCCTGAAGTTG Chr7:109144998..109145017 59.69 45
downstream ENSMUSE00000633238 Chr7:109146589..109146711 CAGCCGAGTTGCTTGATCTT Chr7:109146663..109146682 60.54 50
downstream ENSMUSE00000528763 Chr7:109146814..109150173 TGTGCTTCTTGTCGCATTTC Chr7:109150064..109150083 59.99 45
downstream ENSMUSE00000528759 Chr7:109156000..109156068 TGGTCATGCTCTGTCAGCTT Chr7:109156040..109156059 59.58 50
downstream ENSMUSE00000528756 Chr7:109157605..109157724 GACCTCTTGCTGGCTTTCAC Chr7:109157646..109157665 60 55
downstream ENSMUSE00000528753 Chr7:109157808..109158026 GTTCCTGCAGCTTTTGGTTC Chr7:109157871..109157890 59.86 50
downstream ENSMUSE00000528751 Chr7:109158131..109158288 TCACGGCTCTTTAAGGCATC Chr7:109158207..109158226 60.35 50
downstream ENSMUSE00000528748 Chr7:109159347..109159593 ACCATCTGGTTGGGTACGAG Chr7:109159377..109159396 59.84 55
downstream ENSMUSE00000528744 Chr7:109160395..109160623 CTGCGTGCTGTAGAAGGATG Chr7:109160451..109160470 59.62 55
downstream ENSMUSE00000528740 Chr7:109161256..109161392 TGGACTCCAGAGGGTAGCAG Chr7:109161393..109161412 60.4 60
downstream ENSMUSE00000528736 Chr7:109161683..109161859 CTGGCTCTACGCAAGGTTTC Chr7:109161762..109161781 60.01 55
downstream ENSMUSE00000528733 Chr7:109162044..109162160 GCTGCTCTGCTTACGTCCTT Chr7:109162121..109162140 59.79 55
downstream ENSMUSE00000528729 Chr7:109162252..109162455 TTGAAGCTCCTCGCCTTAGA Chr7:109162339..109162358 60.23 50
downstream ENSMUSE00000671673 Chr7:109162750..109163472 ACCCCTGAGATCCAGAACCT Chr7:109163321..109163340 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCTGTTGGCTCTGCTGAC Chr7:109121486..109121506 59.58 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCTGTTGGCTCTGCTGAC Chr7:109121486..109121506 59.58 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066306