Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1743
Trapped Gene
Phf21b (ENSMUSG00000016624)
Vector Insertion
Chr 15: 84638589 - 84685168
Public Clones CF0549 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000316416 (Chr15:84685169..84685234 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000316416 (Chr15:84685169..84685234 -)
Downstram Exon
ENSMUSE00000316405 (Chr15:84638496..84638588 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000622438 Chr15:84686095..84686479 No primer for this exon
upstream ENSMUSE00000555705 Chr15:84685421..84685529 No primer for this exon
upstream ENSMUSE00000316416 Chr15:84685169..84685234 No primer for this exon

*** Putative Vector Insertion (Chr 15: 84638589 - 84685168) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000316405 Chr15:84638496..84638588 No primer for this exon
downstream ENSMUSE00000126590 Chr15:84635190..84635540 No primer for this exon
downstream ENSMUSE00000680328 Chr15:84635184..84635540 No primer for this exon
downstream ENSMUSE00000680327 Chr15:84634160..84634205 No primer for this exon
downstream ENSMUSE00000126584 Chr15:84633884..84634015 No primer for this exon
downstream ENSMUSE00000680326 Chr15:84633884..84634116 No primer for this exon
downstream ENSMUSE00000126577 Chr15:84629073..84629124 No primer for this exon
downstream ENSMUSE00000126589 Chr15:84627753..84627829 No primer for this exon
downstream ENSMUSE00000126580 Chr15:84625510..84625564 No primer for this exon
downstream ENSMUSE00000464548 Chr15:84624326..84624348 No primer for this exon
downstream ENSMUSE00000126578 Chr15:84622213..84622371 No primer for this exon
downstream ENSMUSE00000126592 Chr15:84621784..84621859 No primer for this exon
downstream ENSMUSE00000126582 Chr15:84621495..84621598 No primer for this exon
downstream ENSMUSE00000336997 Chr15:84615814..84617879 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr15:84661098..84661118 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGCTGAGTGGACGTGAAT Chr15:84661182..84661202 59.42 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000016624