Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17444
Trapped Gene
Msmb (ENSMUSG00000021907)
Vector Insertion
Chr 14: 32955261 - 32961261
Public Clones not available
Private Clones OST442866 (lexicon) OST388542 (lexicon) OST369760 (lexicon) OST127462 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690095 (Chr14:32955241..32955260 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690095 (Chr14:32955241..32955260 +)
Downstram Exon
ENSMUSE00000121897 (Chr14:32961262..32961367 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TAAGAGACTGCCCAGCCAAG Chr14:32961288..32961307 60.53 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690095 Chr14:32955241..32955260 No primer for this exon

*** Putative Vector Insertion (Chr 14: 32955261 - 32961261) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000121897 Chr14:32961262..32961367 TAAGAGACTGCCCAGCCAAG Chr14:32961288..32961307 60.53 55
downstream ENSMUSE00000121898 Chr14:32963349..32963451 CCACGTGCAGTTCTTCTTCC Chr14:32963416..32963435 60.83 55
downstream ENSMUSE00000393571 Chr14:32971253..32971513 TTCCGATCCACCACACTGTA Chr14:32971342..32971361 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:32955311..32955331 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCTGCTCATTCTTCACTCC Chr14:32955221..32955242 60.53 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021907