Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17456
Trapped Gene
Plac9 (ENSMUSG00000072681)
Vector Insertion
Chr 14: 26710342 - 26722271
Public Clones CMHD-GT_474H5-3 (cmhd) IST12662E5 (tigm) IST14671A3 (tigm) IST13233C1 (tigm)
IST11454H3 (tigm) IST14162A7 (tigm) IST12781H6 (tigm) IST14893E12 (tigm)
IST12781H6 (tigm) IST14351D4 (tigm) IST14378H5 (tigm) IST13571C4 (tigm)
Private Clones OST442525 (lexicon) OST428091 (lexicon) OST427444 (lexicon) OST427225 (lexicon)
OST423534 (lexicon) OST422932 (lexicon) OST418787 (lexicon) OST409185 (lexicon)
OST394884 (lexicon) OST378587 (lexicon) OST378580 (lexicon) OST313805 (lexicon)
OST205799 (lexicon) OST132815 (lexicon) OST132221 (lexicon) OST115577 (lexicon)
OST108430 (lexicon) OST60839 (lexicon) OST35208 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000650467 (Chr14:26722272..26722368 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000650467 (Chr14:26722272..26722368 -)
Downstram Exon
ENSMUSE00000650466 (Chr14:26710247..26710341 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATGTCTAACCGCCTTTGCAC Chr14:26710235..26710254 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650467 Chr14:26722272..26722368 No primer for this exon

*** Putative Vector Insertion (Chr 14: 26710342 - 26722271) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000650466 Chr14:26710247..26710341 ATGTCTAACCGCCTTTGCAC Chr14:26710235..26710254 60.14 50
downstream ENSMUSE00000650465 Chr14:26708382..26708505 GGGAAGGTTTGAAGCCAGTT Chr14:26708400..26708419 60.48 50
downstream ENSMUSE00000691363 Chr14:26706998..26708012 GTCTGGCGAAAGCCTGATAC Chr14:26707094..26707113 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAATCGCCTTGCAGCACA Chr14:26722202..26722222 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTTATCGTGACTGGGAAAAC Chr14:26722205..26722227 58.16 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCGACTACGGACAAACTGCT Chr14:26710396..26710416 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGTGGCTACGTACCATGCAG Chr14:26710361..26710381 61.51 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072681