Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17457
Trapped Gene
Mapt (ENSMUSG00000018411)
Vector Insertion
Chr 11: 104189285 - 104189502
Public Clones CMHD-GT_466G6-3 (cmhd)
Private Clones OST442476 (lexicon) OST102994 (lexicon) OST29295 (lexicon) OST23751 (lexicon)
OST19536 (lexicon) OST18069 (lexicon) OST10583 (lexicon) OST10490 (lexicon)
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000381052 (Chr11:104189286..104189555 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000381052 (Chr11:104189286..104189555 +)
Downstram Exon
ENSMUSE00000671766 (Chr11:104189286..104189501 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503576 Chr11:104092812..104092921 No primer for this exon
upstream ENSMUSE00000357735 Chr11:104143682..104143794 No primer for this exon
upstream ENSMUSE00000671767 Chr11:104143695..104143794 No primer for this exon
upstream ENSMUSE00000107966 Chr11:104148437..104148523 No primer for this exon
upstream ENSMUSE00000107958 Chr11:104151222..104151308 No primer for this exon
upstream ENSMUSE00000710380 Chr11:104156173..104156238 No primer for this exon
upstream ENSMUSE00000721123 Chr11:104156173..104156238 No primer for this exon
upstream ENSMUSE00000671771 Chr11:104159812..104160570 No primer for this exon
upstream ENSMUSE00000107959 Chr11:104159860..104160570 No primer for this exon
upstream ENSMUSE00000107970 Chr11:104163675..104163724 No primer for this exon
upstream ENSMUSE00000671756 Chr11:104163675..104163724 No primer for this exon
upstream ENSMUSE00000107957 Chr11:104166526..104166723 No primer for this exon
upstream ENSMUSE00000671755 Chr11:104167940..104168072 No primer for this exon
upstream ENSMUSE00000708822 Chr11:104167940..104168072 No primer for this exon
upstream ENSMUSE00000713313 Chr11:104167940..104168072 No primer for this exon
upstream ENSMUSE00000671768 Chr11:104169195..104169248 No primer for this exon
upstream ENSMUSE00000107971 Chr11:104171583..104171848 No primer for this exon
upstream ENSMUSE00000671764 Chr11:104171583..104171848 No primer for this exon
upstream ENSMUSE00000107965 Chr11:104179471..104179563 No primer for this exon
upstream ENSMUSE00000671763 Chr11:104179471..104179563 No primer for this exon
upstream ENSMUSE00000107964 Chr11:104182665..104182746 No primer for this exon
upstream ENSMUSE00000671762 Chr11:104182665..104182746 No primer for this exon
upstream ENSMUSE00000107967 Chr11:104183742..104183854 No primer for this exon
upstream ENSMUSE00000671761 Chr11:104183742..104183854 No primer for this exon

*** Putative Vector Insertion (Chr 11: 104189285 - 104189502) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000381052 Chr11:104189286..104189555 No primer for this exon
downstream ENSMUSE00000509438 Chr11:104189286..104189555 No primer for this exon
downstream ENSMUSE00000671766 Chr11:104189286..104189501 No primer for this exon
downstream ENSMUSE00000671774 Chr11:104189286..104189493 No primer for this exon
downstream ENSMUSE00000671772 Chr11:104190416..104190492 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGCCAAAGCCAAGACAGT Chr11:104189317..104189337 59.74 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAGATTGAAACCCACAAG Chr11:104189282..104189302 59.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018411