Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17458
Trapped Gene
1110051M20Rik (ENSMUSG00000040591)
Vector Insertion
Chr 2: 91262126 - 91284725
Public Clones IST12255C12 (tigm) IST13725F6 (tigm) IST12255C12 (tigm) IST14714C4 (tigm)
IST10051H12 (tigm)
Private Clones OST442416 (lexicon) OST433944 (lexicon) OST432699 (lexicon) OST420179 (lexicon)
OST418390 (lexicon) OST359724 (lexicon) OST358370 (lexicon) OST334351 (lexicon)
OST331304 (lexicon) OST162568 (lexicon) OST162567 (lexicon) OST116092 (lexicon)
OST78380 (lexicon) OST66936 (lexicon) OST66918 (lexicon) OST63969 (lexicon)
OST33982 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662037 (Chr2:91284726..91284798 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAAACTACCCGGTCAAAG Chr2:91284773..91284792 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662037 (Chr2:91284726..91284798 -)
Downstram Exon
ENSMUSE00000662036 (Chr2:91262023..91262125 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAAACTACCCGGTCAAAG Chr2:91284773..91284792 59.96 50 CCTCCATGTACGTGAGGACA Chr2:91262074..91262093 59.54 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000600112 Chr2:91284726..91284837 TGGAAACTACCCGGTCAAAG Chr2:91284773..91284792 59.96 50
upstream ENSMUSE00000662037 Chr2:91284726..91284798 TGGAAACTACCCGGTCAAAG Chr2:91284773..91284792 59.96 50
upstream ENSMUSE00000687518 Chr2:91284726..91284835 TGGAAACTACCCGGTCAAAG Chr2:91284773..91284792 59.96 50

*** Putative Vector Insertion (Chr 2: 91262126 - 91284725) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662036 Chr2:91262023..91262125 CCTCCATGTACGTGAGGACA Chr2:91262074..91262093 59.54 55
downstream ENSMUSE00000302929 Chr2:91223886..91224016 GTTCCTTGGCATACGCTGTT Chr2:91223971..91223990 60.14 50
downstream ENSMUSE00000687517 Chr2:91223886..91224016 GTTCCTTGGCATACGCTGTT Chr2:91223971..91223990 60.14 50
downstream ENSMUSE00000302919 Chr2:91144906..91144990 GGTACTCCCTCATGGTCAGC Chr2:91144945..91144964 59.53 60
downstream ENSMUSE00000687516 Chr2:91144906..91144990 GGTACTCCCTCATGGTCAGC Chr2:91144945..91144964 59.53 60
downstream ENSMUSE00000450424 Chr2:91124392..91124477 GCATCATCCATGAGCACAAT Chr2:91124435..91124454 59.49 45
downstream ENSMUSE00000302903 Chr2:91122622..91122817 GTTTTCCAGGCGCTGATAGA Chr2:91122623..91122642 60.35 50
downstream ENSMUSE00000302896 Chr2:91121903..91122012 GGTTGATCCCATGATGCTTT Chr2:91121890..91121909 59.76 45
downstream ENSMUSE00000302888 Chr2:91119347..91119410 GTCGTGCATCAGGTCTCCTT Chr2:91119354..91119373 60.27 55
downstream ENSMUSE00000662035 Chr2:91118402..91119114 GCACATGCTCTCAGGAATCA Chr2:91118529..91118548 59.95 50
downstream ENSMUSE00000600111 Chr2:91118401..91119114 GCACATGCTCTCAGGAATCA Chr2:91118529..91118548 59.95 50
downstream ENSMUSE00000687519 Chr2:91117132..91117291 AAAGCTGAGGGCACTGTCTC Chr2:91117153..91117172 59.6 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTAATCGCCTTGCAGCACA Chr2:91269656..91269676 62.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATCCTGGGTCCTCCTTCTG Chr2:91269730..91269750 60.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTGAGTGCTGGGCTTTGAT Chr2:91269776..91269796 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACTGAGTGCTGGGCTTTGAT Chr2:91269776..91269796 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040591