Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1746
Trapped Gene
Metap1 (ENSMUSG00000005813)
Vector Insertion
Chr 3: 138146083 - 138152221
Public Clones CF0535 (sanger) RRC272 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000406271 (Chr3:138152222..138152365 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000406271 (Chr3:138152222..138152365 -)
Downstram Exon
ENSMUSE00000176809 (Chr3:138146031..138146082 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406271 Chr3:138152222..138152365 No primer for this exon

*** Putative Vector Insertion (Chr 3: 138146083 - 138152221) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176809 Chr3:138146031..138146082 No primer for this exon
downstream ENSMUSE00000176812 Chr3:138143652..138143764 No primer for this exon
downstream ENSMUSE00000176807 Chr3:138141834..138141894 No primer for this exon
downstream ENSMUSE00000176811 Chr3:138137951..138138042 No primer for this exon
downstream ENSMUSE00000176804 Chr3:138136868..138136951 No primer for this exon
downstream ENSMUSE00000176806 Chr3:138135115..138135253 No primer for this exon
downstream ENSMUSE00000176810 Chr3:138131798..138131929 No primer for this exon
downstream ENSMUSE00000176803 Chr3:138129188..138129331 No primer for this exon
downstream ENSMUSE00000176808 Chr3:138125329..138125394 No primer for this exon
downstream ENSMUSE00000364416 Chr3:138123099..138123464 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCCAGGGCTCGTACTTCT Chr3:138149228..138149248 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCGTCACTGTACTTGTAGGC Chr3:138149241..138149262 59.67 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005813