Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17465
Trapped Gene
Slc19a1 (ENSMUSG00000001436)
Vector Insertion
Chr 10: 76496093 - 76501094
Public Clones IST14640H3 (tigm)
Private Clones OST442237 (lexicon) OST288389 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666077 (Chr10:76496004..76496092 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666077 (Chr10:76496004..76496092 +)
Downstram Exon
ENSMUSE00000373341 (Chr10:76501095..76501324 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666077 Chr10:76496004..76496092 No primer for this exon

*** Putative Vector Insertion (Chr 10: 76496093 - 76501094) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000373341 Chr10:76501095..76501324 No primer for this exon
downstream ENSMUSE00000102549 Chr10:76504561..76505314 No primer for this exon
downstream ENSMUSE00000666076 Chr10:76505527..76505719 No primer for this exon
downstream ENSMUSE00000666073 Chr10:76505849..76505855 No primer for this exon
downstream ENSMUSE00000666075 Chr10:76507506..76507647 No primer for this exon
downstream ENSMUSE00000666074 Chr10:76512285..76513171 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTGCCCTTATTGGCTGTT Chr10:76499096..76499116 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGCCCTTATTGGCTGTT Chr10:76499096..76499116 60.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001436