Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17468
Trapped Gene
A930034L06Rik (ENSMUSG00000044349)
Vector Insertion
Chr 2: 158201625 - 158201935
Public Clones not available
Private Clones OST442178 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680532 (Chr2:158201374..158201624 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACCCTTGAGAGCTATGG Chr2:158201574..158201593 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680532 (Chr2:158201374..158201624 +)
Downstram Exon
ENSMUSE00000341642 (Chr2:158201936..158202034 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACCCTTGAGAGCTATGG Chr2:158201574..158201593 59.69 55 CGTCATCCTTGGTGTCAAGA Chr2:158201980..158201999 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680532 Chr2:158201374..158201624 CCAACCCTTGAGAGCTATGG Chr2:158201574..158201593 59.69 55

*** Putative Vector Insertion (Chr 2: 158201625 - 158201935) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000680531 Chr2:158201817..158202062 TCCTAGGGTCCTGGGCTTAT Chr2:158201875..158201894 59.92 55
downstream ENSMUSE00000341642 Chr2:158201936..158202034 CGTCATCCTTGGTGTCAAGA Chr2:158201980..158201999 59.68 50
downstream ENSMUSE00000387551 Chr2:158202037..158202062 TACTTGCTTCCTGGATGGTG Chr2:158202060..158202079 58.72 50
downstream ENSMUSE00000350440 Chr2:158202730..158202808 CACCTCTCATGTCCCCTCTG Chr2:158202768..158202787 60.67 60
downstream ENSMUSE00000680530 Chr2:158202730..158202808 CACCTCTCATGTCCCCTCTG Chr2:158202768..158202787 60.67 60
downstream ENSMUSE00000385142 Chr2:158206507..158206587 GTCGCTCCACACTGATGTTG Chr2:158206541..158206560 60.32 55
downstream ENSMUSE00000680529 Chr2:158206507..158206587 GTCGCTCCACACTGATGTTG Chr2:158206541..158206560 60.32 55
downstream ENSMUSE00000466942 Chr2:158206675..158206737 CTCTTCCTGGGTACCACCAC Chr2:158206703..158206722 59.42 60
downstream ENSMUSE00000680527 Chr2:158206675..158211881 AGCCCCACTCAACCCTACTT Chr2:158211623..158211642 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr2:158201674..158201694 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGGGCTACAGTTGAGCTT Chr2:158201655..158201675 59.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044349