Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17470
Trapped Gene
Cic (ENSMUSG00000005442)
Vector Insertion
Chr 7: 26067936 - 26069867
Public Clones IST10061E1 (tigm)
Private Clones OST442112 (lexicon) OST436357 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314797 (Chr7:26067198..26067935 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314797 (Chr7:26067198..26067935 +)
Downstram Exon
ENSMUSE00000314793 (Chr7:26069868..26070017 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000598322 Chr7:26055865..26058652 No primer for this exon
upstream ENSMUSE00000314797 Chr7:26067198..26067935 No primer for this exon

*** Putative Vector Insertion (Chr 7: 26067936 - 26069867) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000314793 Chr7:26069868..26070017 No primer for this exon
downstream ENSMUSE00000199504 Chr7:26070098..26070332 No primer for this exon
downstream ENSMUSE00000199519 Chr7:26070429..26070558 No primer for this exon
downstream ENSMUSE00000199507 Chr7:26070653..26070835 No primer for this exon
downstream ENSMUSE00000199511 Chr7:26070917..26071082 No primer for this exon
downstream ENSMUSE00000199512 Chr7:26071826..26072028 No primer for this exon
downstream ENSMUSE00000199516 Chr7:26072120..26072345 No primer for this exon
downstream ENSMUSE00000199506 Chr7:26072769..26072872 No primer for this exon
downstream ENSMUSE00000314751 Chr7:26073093..26074320 No primer for this exon
downstream ENSMUSE00000199515 Chr7:26074407..26074594 No primer for this exon
downstream ENSMUSE00000199521 Chr7:26075590..26075711 No primer for this exon
downstream ENSMUSE00000199518 Chr7:26075818..26075984 No primer for this exon
downstream ENSMUSE00000314732 Chr7:26076071..26076361 No primer for this exon
downstream ENSMUSE00000636453 Chr7:26076074..26076361 No primer for this exon
downstream ENSMUSE00000676653 Chr7:26076463..26076788 No primer for this exon
downstream ENSMUSE00000199517 Chr7:26076469..26076788 No primer for this exon
downstream ENSMUSE00000199513 Chr7:26077083..26077333 No primer for this exon
downstream ENSMUSE00000199508 Chr7:26077433..26077587 No primer for this exon
downstream ENSMUSE00000636451 Chr7:26077436..26077587 No primer for this exon
downstream ENSMUSE00000199510 Chr7:26077669..26077800 No primer for this exon
downstream ENSMUSE00000199520 Chr7:26077975..26078106 No primer for this exon
downstream ENSMUSE00000199505 Chr7:26078187..26079161 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTGCAGGGGTCAATGTGT Chr7:26067958..26067978 61 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTGCAGGGGTCAATGTGT Chr7:26067958..26067978 61 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005442