Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17483
Trapped Gene
EG434225 (ENSMUSG00000057215)
Vector Insertion
Chr 7: 114428452 - 114429126
Public Clones not available
Private Clones OST441897 (lexicon) OST439455 (lexicon) OST277488 (lexicon) OST205694 (lexicon)
OST55583 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000483759 (Chr7:114428288..114428451 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGCACACACTGCCTACCA Chr7:114428362..114428381 59.37 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000483759 (Chr7:114428288..114428451 +)
Downstram Exon
ENSMUSE00000467585 (Chr7:114429127..114429244 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGCACACACTGCCTACCA Chr7:114428362..114428381 59.37 50 CTCAACAGCAAAGGGACCTC Chr7:114429203..114429222 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000483759 Chr7:114428288..114428451 AAAGCACACACTGCCTACCA Chr7:114428362..114428381 59.37 50

*** Putative Vector Insertion (Chr 7: 114428452 - 114429126) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000467585 Chr7:114429127..114429244 CTCAACAGCAAAGGGACCTC Chr7:114429203..114429222 59.84 55
downstream ENSMUSE00000671068 Chr7:114429681..114429694 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACCTGAATAATCGCCTTG Chr7:114428494..114428514 60.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000057215