Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17484
Trapped Gene
Tshz2 (ENSMUSG00000047907)
Vector Insertion
Chr 2: 169738107 - 169738594
Public Clones not available
Private Clones OST441893 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000638955 (Chr2:169738108..169738594 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGTTCGGCTGTCTGTTCGT Chr2:169738405..169738424 59.91 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000638955 (Chr2:169738108..169738594 +)
Downstram Exon
ENSMUSE00000679203 (Chr2:169738108..169738593 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGTTCGGCTGTCTGTTCGT Chr2:169738405..169738424 59.91 50 TGGCTTTCAGTCTCGTGTTG Chr2:169738144..169738163 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638958 Chr2:169458671..169459246 AGAAAGACGAGCGAGACTGC Chr2:169459160..169459179 59.9 55
upstream ENSMUSE00000679207 Chr2:169458671..169459279 AAGTAGAGCGATGCCAAGGA Chr2:169459230..169459249 59.98 50
upstream ENSMUSE00000679199 Chr2:169459176..169459279 AAGTAGAGCGATGCCAAGGA Chr2:169459230..169459249 59.98 50
upstream ENSMUSE00000679210 Chr2:169459240..169459279 No primer for this exon
upstream ENSMUSE00000638957 Chr2:169616466..169616488 No primer for this exon
upstream ENSMUSE00000638956 Chr2:169709013..169712086 GTTTCGAGCGAAGTCTCCAC Chr2:169711464..169711483 60 55
upstream ENSMUSE00000549280 Chr2:169709026..169709460 AGCAAACACTCACCCCAAAC Chr2:169709309..169709328 60.01 50
upstream ENSMUSE00000679198 Chr2:169709026..169714004 GTTTCGAGCGAAGTCTCCAC Chr2:169711464..169711483 60 55
upstream ENSMUSE00000679205 Chr2:169709026..169712086 GTTTCGAGCGAAGTCTCCAC Chr2:169711464..169711483 60 55
upstream ENSMUSE00000549278 Chr2:169709668..169712078 GTTTCGAGCGAAGTCTCCAC Chr2:169711464..169711483 60 55

*** Putative Vector Insertion (Chr 2: 169738107 - 169738594) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638955 Chr2:169738108..169738594 TGGCTTTCAGTCTCGTGTTG Chr2:169738144..169738163 60.03 50
downstream ENSMUSE00000679203 Chr2:169738108..169738593 TGGCTTTCAGTCTCGTGTTG Chr2:169738144..169738163 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGCTTCCGTCCTCAGAGT Chr2:169738092..169738112 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGCTTCCGTCCTCAGAGT Chr2:169738092..169738112 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047907