Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17494
Trapped Gene
Napepld (ENSMUSG00000044968)
Vector Insertion
Chr 5: 21168718 - 21171181
Public Clones PSTVUpb18a12 (vanderbilt)
Private Clones OST441753 (lexicon) OST314903 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000552507 (Chr5:21168798..21171180 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCAATATGAGCGACCATC Chr5:21169384..21169403 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000552507 (Chr5:21168798..21171180 -)
Downstram Exon
ENSMUSE00000702080 (Chr5:21168719..21171180 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCAATATGAGCGACCATC Chr5:21169384..21169403 60.07 50 CCATCCCTAGACTCCCACAA Chr5:21170866..21170885 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458392 Chr5:21207023..21207185 CTCGATATCTGCGTGGAACA Chr5:21207072..21207091 59.82 50
upstream ENSMUSE00000655629 Chr5:21206793..21207212 GCTGTTAGCCTGGATCTTCG Chr5:21207143..21207162 59.98 55
upstream ENSMUSE00000386128 Chr5:21189231..21189263 AGTATGAGGACAGCCAGTCTCC Chr5:21189239..21189260 59.77 54.54
upstream ENSMUSE00000336105 Chr5:21188974..21189228 ACATCTCCATCCCGAATGTG Chr5:21189028..21189047 60.75 50
upstream ENSMUSE00000359041 Chr5:21188974..21189283 GCGCCAAGCTATCAGTATCC Chr5:21189218..21189237 59.83 55
upstream ENSMUSE00000715725 Chr5:21188974..21189283 GCGCCAAGCTATCAGTATCC Chr5:21189218..21189237 59.83 55
upstream ENSMUSE00000401164 Chr5:21181273..21181919 TCCCATCGGAGCTTATGAAC Chr5:21181277..21181296 60.04 50
upstream ENSMUSE00000383623 Chr5:21176307..21176421 AGCATGCAGACCCAGAAGAT Chr5:21176385..21176404 59.83 50
upstream ENSMUSE00000552507 Chr5:21168798..21171180 AGCCAATATGAGCGACCATC Chr5:21169384..21169403 60.07 50
upstream ENSMUSE00000702080 Chr5:21168719..21171180 AGCCAATATGAGCGACCATC Chr5:21169384..21169403 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTACCTAGAGCCGCCAGTG Chr5:21171158..21171178 59.36 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTACCTAGAGCCGCCAGTG Chr5:21171158..21171178 59.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044968