Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17500
Trapped Gene
Gsta2 (ENSMUSG00000057933)
Vector Insertion
Chr 9: 78181710 - 78185365
Public Clones not available
Private Clones OST441610 (lexicon) OST275559 (lexicon) OST221464 (lexicon) OST214423 (lexicon)
OST35863 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000531602 (Chr9:78185366..78185498 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCAACTACATCGCCACCA Chr9:78185406..78185425 60.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000531602 (Chr9:78185366..78185498 -)
Downstram Exon
ENSMUSE00000487804 (Chr9:78181568..78181709 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCAACTACATCGCCACCA Chr9:78185406..78185425 60.26 50 CAAGGCAGTCTTGGCTTCTC Chr9:78181591..78181610 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414567 Chr9:78194896..78194957 GATTGGGAGCTGAGTGGAGA Chr9:78194917..78194936 60.35 55
upstream ENSMUSE00000218928 Chr9:78189637..78189745 AGCCCGTGCTTCACTACTTC Chr9:78189694..78189713 59.5 55
upstream ENSMUSE00000218923 Chr9:78186452..78186503 CAGAGTCCGGAAGATTTGGA Chr9:78186466..78186485 60.19 50
upstream ENSMUSE00000531602 Chr9:78185366..78185498 TCTCAACTACATCGCCACCA Chr9:78185406..78185425 60.26 50

*** Putative Vector Insertion (Chr 9: 78181710 - 78185365) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487804 Chr9:78181568..78181709 CAAGGCAGTCTTGGCTTCTC Chr9:78181591..78181610 60.13 55
downstream ENSMUSE00000467995 Chr9:78179894..78180025 CCTGTTGCCCACAAGGTAGT Chr9:78179962..78179981 60.03 55
downstream ENSMUSE00000461487 Chr9:78178826..78179056 GAGGCTGCTGATTCTGCTCT Chr9:78179008..78179027 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGAGAGCCCTGTATGACG Chr9:78185356..78185376 59.83 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGAGAGCCCTGTATGACG Chr9:78185356..78185376 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057933