Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17514
Trapped Gene
G3bp2 (ENSMUSG00000029405)
Vector Insertion
Chr 5: 92499465 - 92502185
Public Clones not available
Private Clones OST441271 (lexicon) OST346002 (lexicon) OST308285 (lexicon) OST277606 (lexicon)
OST250413 (lexicon) OST239329 (lexicon) OST232464 (lexicon) OST208885 (lexicon)
OST208074 (lexicon) OST205668 (lexicon) OST185037 (lexicon) OST184541 (lexicon)
OST178901 (lexicon) OST167155 (lexicon) OST106100 (lexicon) OST47427 (lexicon)
OST36462 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000188561 (Chr5:92502186..92502304 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCTCCCGAGTATTTGCAC Chr5:92502188..92502207 59.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000188561 (Chr5:92502186..92502304 -)
Downstram Exon
ENSMUSE00000188551 (Chr5:92499383..92499464 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCTCCCGAGTATTTGCAC Chr5:92502188..92502207 59.34 50 TTTGGCCATAAACTGCTTCC Chr5:92499363..92499382 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513954 Chr5:92512555..92512684 No primer for this exon
upstream ENSMUSE00000188561 Chr5:92502186..92502304 AAGCTCCCGAGTATTTGCAC Chr5:92502188..92502207 59.34 50

*** Putative Vector Insertion (Chr 5: 92499465 - 92502185) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188551 Chr5:92499383..92499464 TTTGGCCATAAACTGCTTCC Chr5:92499363..92499382 60.07 45
downstream ENSMUSE00000188547 Chr5:92497351..92497524 CTTCCTCTCAGGCTGTCCAC Chr5:92497359..92497378 59.99 60
downstream ENSMUSE00000323144 Chr5:92495518..92495608 No primer for this exon
downstream ENSMUSE00000188545 Chr5:92494778..92494880 TCTTGCACAGGTTCAGGAGA Chr5:92494795..92494814 59.54 50
downstream ENSMUSE00000188556 Chr5:92493351..92493531 AGGCTCAGGTTCATGAGAGG Chr5:92493461..92493480 59.4 55
downstream ENSMUSE00000188546 Chr5:92492363..92492461 CACTGAAGCCCAGGAGAAAG Chr5:92492419..92492438 59.98 55
downstream ENSMUSE00000188558 Chr5:92486994..92487096 TGGCTGAGACTGAACTTCTGG Chr5:92487036..92487056 60.57 52.38
downstream ENSMUSE00000323118 Chr5:92485295..92485423 TTCTCCGGTTGTCAGAGTCA Chr5:92485360..92485379 59.39 50
downstream ENSMUSE00000323110 Chr5:92484410..92484528 TTGGTATTGATGCGAAGTTCC Chr5:92484470..92484490 59.95 42.86
downstream ENSMUSE00000597268 Chr5:92483540..92484079 GTCACGATCACGCATCATTC Chr5:92483884..92483903 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCTCCCGAGTATTTGCAC Chr5:92502186..92502206 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCTCCCGAGTATTTGCAC Chr5:92502186..92502206 59.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029405