Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17516
Trapped Gene
Atp5e (ENSMUSG00000016252)
Vector Insertion
Chr 2: 174288131 - 174289465
Public Clones (sanger) (sanger) (sanger) 3SE284D06 (ggtc) 5SE386A10 (ggtc)
5SE284D06 (ggtc) IST10673F9 (tigm)
Private Clones OST441248 (lexicon) OST377848 (lexicon) OST347229 (lexicon) OST346342 (lexicon)
OST329031 (lexicon) OST238525 (lexicon) OST181825 (lexicon) OST124049 (lexicon)
OST63694 (lexicon) OST62993 (lexicon) OST54778 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000390028 (Chr2:174289466..174289592 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000390028 (Chr2:174289466..174289592 -)
Downstram Exon
ENSMUSE00000170293 (Chr2:174288001..174288130 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000390028 Chr2:174289466..174289592 No primer for this exon

*** Putative Vector Insertion (Chr 2: 174288131 - 174289465) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170293 Chr2:174288001..174288130 No primer for this exon
downstream ENSMUSE00000170291 Chr2:174286576..174286722 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTCACCAGGCCGTATAATC Chr2:174289409..174289429 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGAGGCTACTCGTGACTGG Chr2:174289533..174289553 59.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000016252