Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17518
Trapped Gene
Aes (ENSMUSG00000054452)
Vector Insertion
Chr 10: 81027463 - 81027592
Public Clones not available
Private Clones OST441222 (lexicon) OST199124 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000574606 (Chr10:81027418..81027462 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTACGGATTGAACATCGAGA Chr10:81027431..81027451 60.08 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000574606 (Chr10:81027418..81027462 +)
Downstram Exon
ENSMUSE00000298726 (Chr10:81027593..81027655 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTACGGATTGAACATCGAGA Chr10:81027431..81027451 60.08 47.62 ATCCCATTCAGCCTCTTCAC Chr10:81027624..81027643 59.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641506 Chr10:81022348..81022413 CGCGACTGACATGATGTTTC Chr10:81022377..81022396 60.27 50
upstream ENSMUSE00000665809 Chr10:81023923..81023964 No primer for this exon
upstream ENSMUSE00000298746 Chr10:81023964..81024061 CAAGTTCACCACCTCCGACT Chr10:81023990..81024009 60.15 55
upstream ENSMUSE00000665808 Chr10:81023967..81024061 CAAGTTCACCACCTCCGACT Chr10:81023990..81024009 60.15 55
upstream ENSMUSE00000574607 Chr10:81026840..81026903 GCCAGCGAGAAGTCAGAGAT Chr10:81026865..81026884 59.71 55
upstream ENSMUSE00000574606 Chr10:81027418..81027462 CCTACGGATTGAACATCGAGA Chr10:81027431..81027451 60.08 47.62

*** Putative Vector Insertion (Chr 10: 81027463 - 81027592) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000298726 Chr10:81027593..81027655 ATCCCATTCAGCCTCTTCAC Chr10:81027624..81027643 59.09 50
downstream ENSMUSE00000102269 Chr10:81028037..81028111 GTGACCTGCTTGGCTCTCTC Chr10:81028086..81028105 60.14 60
downstream ENSMUSE00000368559 Chr10:81028217..81028909 CCTTCCCCAAGAGCTAATCC Chr10:81028454..81028473 60.03 55
downstream ENSMUSE00000705336 Chr10:81028217..81028438 AATCCGACTTCTCTCCGTCA Chr10:81028439..81028458 59.8 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCTCCTCCATGTCCTCAA Chr10:81027476..81027496 60.05 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCTCCTCCATGTCCTCAA Chr10:81027476..81027496 60.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054452