Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17521
Trapped Gene
Ints5 (ENSMUSG00000071652)
Vector Insertion
Chr 19: 8967639 - 8969248
Public Clones (sanger) IST10453F1 (tigm) IST14711G2 (tigm) IST14375H4 (tigm) IST14838A4 (tigm)
IST10513F2 (tigm) IST14838A4 (tigm)
Private Clones OST441192 (lexicon) OST378211 (lexicon) OST347417 (lexicon) OST346168 (lexicon)
OST309413 (lexicon) OST269683 (lexicon) OST219815 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621617 (Chr19:8967505..8967638 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621617 (Chr19:8967505..8967638 +)
Downstram Exon
ENSMUSE00000621616 (Chr19:8969249..8972371 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AACGGAGCAAGAGAAGACCA Chr19:8969364..8969383 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621617 Chr19:8967505..8967638 No primer for this exon

*** Putative Vector Insertion (Chr 19: 8967639 - 8969248) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000621616 Chr19:8969249..8972371 AACGGAGCAAGAGAAGACCA Chr19:8969364..8969383 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000071652