Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17538
Trapped Gene
C1galt1c1 (ENSMUSG00000048970)
Vector Insertion
Chr X: 35985301 - 35988154
Public Clones 5SE040E08 (ggtc) 3SE040E08 (ggtc) PST17731-NR (escells) IST14354G3 (tigm)
IST11384D7 (tigm) IST12824H7 (tigm)
Private Clones OST440929 (lexicon) OST252747 (lexicon) OST244141 (lexicon) OST146561 (lexicon)
OST101402 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000348820 (ChrX:35988155..35988286 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACACCAACGAGAGGATACCG ChrX:35988264..35988283 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000348820 (ChrX:35988155..35988286 -)
Downstram Exon
ENSMUSE00000355996 (ChrX:35983969..35985300 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACACCAACGAGAGGATACCG ChrX:35988264..35988283 59.99 55 CATCTTTTCCATCGGCATCT ChrX:35984546..35984565 60.04 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000348820 ChrX:35988155..35988286 ACACCAACGAGAGGATACCG ChrX:35988264..35988283 59.99 55

*** Putative Vector Insertion (Chr X: 35985301 - 35988154) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000355996 ChrX:35983969..35985300 CATCTTTTCCATCGGCATCT ChrX:35984546..35984565 60.04 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAAGCACAACCCAGAGCTA ChrX:35988106..35988126 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAAGCACAACCCAGAGCTA ChrX:35988106..35988126 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCCTCTGTTGCTCCGTCAT ChrX:35988287..35988307 60.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCCTCTGTTGCTCCGTCAT ChrX:35988287..35988307 60.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048970