Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17560
Trapped Gene
Mmp25 (ENSMUSG00000023903)
Vector Insertion
Chr 17: 23777242 - 23781005
Public Clones not available
Private Clones OST440735 (lexicon) OST320539 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136262 (Chr17:23781006..23781138 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGACTCGCTATGGCTACC Chr17:23781114..23781133 60.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136262 (Chr17:23781006..23781138 -)
Downstram Exon
ENSMUSE00000136249 (Chr17:23777106..23777241 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGACTCGCTATGGCTACC Chr17:23781114..23781133 60.01 60 GCTTGCGCATGGTCTTTATT Chr17:23777190..23777209 60.24 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000136257 Chr17:23781558..23782236 GACGTTGGAAGATTGGGCTA Chr17:23782046..23782065 60.07 50
upstream ENSMUSE00000136262 Chr17:23781006..23781138 GCTGACTCGCTATGGCTACC Chr17:23781114..23781133 60.01 60

*** Putative Vector Insertion (Chr 17: 23777242 - 23781005) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136249 Chr17:23777106..23777241 GCTTGCGCATGGTCTTTATT Chr17:23777190..23777209 60.24 45
downstream ENSMUSE00000136246 Chr17:23776720..23777009 TCATCAAAGTGCGTGTCTCC Chr17:23776727..23776746 59.84 50
downstream ENSMUSE00000612514 Chr17:23769701..23769877 GGCCAAATTCATGAACTGCT Chr17:23769808..23769827 60.08 45
downstream ENSMUSE00000136250 Chr17:23769516..23769600 GCATTTGGATTTTGGGACAC Chr17:23769554..23769573 60.18 45
downstream ENSMUSE00000521374 Chr17:23768758..23768840 AATTTCCCCTCGAATGTTGG Chr17:23768749..23768768 61.04 45
downstream ENSMUSE00000317184 Chr17:23768310..23768462 GAGGATGATTCGGCCATCTA Chr17:23768295..23768314 60 50
downstream ENSMUSE00000136247 Chr17:23767973..23768230 CTGATGGTGACATCGTCTGG Chr17:23767959..23767978 60.11 55
downstream ENSMUSE00000508774 Chr17:23766425..23767803 CCTACCCTGTGGCAGTGATT Chr17:23766944..23766963 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGGACTACCTGAGACTGGA Chr17:23778011..23778031 60.25 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCCGTGTACAACGTGACTGG Chr17:23777945..23777966 60.88 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023903