Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17568
Trapped Gene
Myst2 (ENSMUSG00000038909)
Vector Insertion
Chr 11: 95167511 - 95170850
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) P135A09 (ggtc) E039B07 (ggtc) (ggtc) P099D03 (ggtc)
D093B11 (ggtc) E087H02 (ggtc) D035C12 (ggtc) (ggtc) P133F06 (ggtc)
D188C09 (ggtc) E138C04 (ggtc) D092D11 (ggtc) P142E04 (ggtc) E087H02 (ggtc)
D035C12 (ggtc) (ggtc) P106H03 (ggtc) D163D06 (ggtc) E138C03 (ggtc)
D092D11 (ggtc) (ggtc) CMHD-GT_506E11-3 (cmhd) PST19053-NL (escells) IST14419B4 (tigm)
IST14884A6 (tigm) IST14464E3 (tigm)
Private Clones OST440612 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674263 (Chr11:95170851..95170871 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674263 (Chr11:95170851..95170871 -)
Downstram Exon
ENSMUSE00000445467 (Chr11:95167363..95167510 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGAATCTTCGGTTCCATCTG Chr11:95167450..95167469 59.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661432 Chr11:95171349..95171515 AGGGTTTGGGACAGCTACAG Chr11:95171450..95171469 59.21 55
upstream ENSMUSE00000674260 Chr11:95170851..95170916 CGGATAGAGATGGCGATAGG Chr11:95170861..95170880 59.65 55
upstream ENSMUSE00000674263 Chr11:95170851..95170871 No primer for this exon

*** Putative Vector Insertion (Chr 11: 95167511 - 95170850) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000445467 Chr11:95167363..95167510 GGAATCTTCGGTTCCATCTG Chr11:95167450..95167469 59.48 50
downstream ENSMUSE00000577649 Chr11:95164447..95164623 GAGCGAGTCTGTCGAAGAGG Chr11:95164469..95164488 60.28 60
downstream ENSMUSE00000648581 Chr11:95161293..95161532 GGAGTTCGAGGTGGTGACTC Chr11:95161465..95161484 59.69 60
downstream ENSMUSE00000648580 Chr11:95155877..95155959 TATGATACAGCGGGCATCCT Chr11:95155878..95155897 60.46 50
downstream ENSMUSE00000577648 Chr11:95152834..95152923 GTTGCATGCCTGTTGTTGTC Chr11:95152822..95152841 60.17 50
downstream ENSMUSE00000648578 Chr11:95151086..95151184 ACCGCAGCTGTCTCTCTGTT Chr11:95151138..95151157 60.21 55
downstream ENSMUSE00000648577 Chr11:95147644..95147754 AGAGAGGCTCCCGAGTGTTC Chr11:95147693..95147712 60.93 60
downstream ENSMUSE00000648576 Chr11:95145343..95145534 GATTTGGCCTTGAAGCCTTA Chr11:95145486..95145505 59.3 45
downstream ENSMUSE00000648574 Chr11:95143153..95143242 GATGGAGCCTTTGCGATAAA Chr11:95143164..95143183 60.17 45
downstream ENSMUSE00000648573 Chr11:95142815..95142955 CAGCCAGTATTGTCCGCTTC Chr11:95142818..95142837 60.8 55
downstream ENSMUSE00000648572 Chr11:95141705..95141798 GATCAGCATCTTCCCGTAGC Chr11:95141690..95141709 59.8 55
downstream ENSMUSE00000648571 Chr11:95138783..95138929 TGGAGAGCCGACTTTCTCTT Chr11:95138867..95138886 59.16 50
downstream ENSMUSE00000648570 Chr11:95137757..95137863 ACGGGATTCACAGCTGTTTC Chr11:95137811..95137830 60.12 50
downstream ENSMUSE00000648569 Chr11:95135574..95137201 CTTGCCAATCACAAGAGCAA Chr11:95136984..95137003 59.99 45
downstream ENSMUSE00000413313 Chr11:95135573..95137201 CTTGCCAATCACAAGAGCAA Chr11:95136984..95137003 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr11:95170782..95170802 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAATCGTGACTGGGAAAAC Chr11:95167784..95167804 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGTAAAGGCGAGTTGGGAAG Chr11:95167836..95167856 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGTAAAGGCGAGTTGGGAAG Chr11:95167836..95167856 60.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038909