Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17576
Trapped Gene
Upf3b (ENSMUSG00000036572)
Vector Insertion
Chr X: 34649142 - 34649250
Public Clones not available
Private Clones OST440452 (lexicon) OST132975 (lexicon) OST29256 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702089 (ChrX:34649143..34649249 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTATGCCTGAGCACGATT ChrX:34649171..34649190 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702089 (ChrX:34649143..34649249 -)
Downstram Exon
ENSMUSE00000315810 (ChrX:34649143..34649249 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTATGCCTGAGCACGATT ChrX:34649171..34649190 59.72 50 AATCGTGCTCAGGCATAGGT ChrX:34649149..34649168 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714894 ChrX:34650071..34650317 ACGAGTGACCCTGTTTACGC ChrX:34650172..34650191 60.18 55
upstream ENSMUSE00000716801 ChrX:34650071..34650317 ACGAGTGACCCTGTTTACGC ChrX:34650172..34650191 60.18 55
upstream ENSMUSE00000315810 ChrX:34649143..34649249 ACCTATGCCTGAGCACGATT ChrX:34649171..34649190 59.72 50
upstream ENSMUSE00000702089 ChrX:34649143..34649249 ACCTATGCCTGAGCACGATT ChrX:34649171..34649190 59.72 50

*** Putative Vector Insertion (Chr X: 34649142 - 34649250) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702096 ChrX:34648948..34649016 No primer for this exon
downstream ENSMUSE00000503226 ChrX:34648910..34649016 CATCAAATCGGTCCCTGAAT ChrX:34648912..34648931 59.75 45
downstream ENSMUSE00000702087 ChrX:34648910..34649016 CATCAAATCGGTCCCTGAAT ChrX:34648912..34648931 59.75 45
downstream ENSMUSE00000315796 ChrX:34644424..34644522 TTTGCAGCTTTTTGAAATGG ChrX:34644449..34644468 58.93 35
downstream ENSMUSE00000315790 ChrX:34642022..34642132 TTGGCTTCAATTTCCTCCAG ChrX:34642017..34642036 60.18 45
downstream ENSMUSE00000315785 ChrX:34640088..34640131 AAGGGGCGTTGTCCTTTTAG ChrX:34640090..34640109 60.47 50
downstream ENSMUSE00000624305 ChrX:34639502..34639684 TTTCCCGTCTCCTCCTTTCT ChrX:34639620..34639639 60.18 50
downstream ENSMUSE00000702085 ChrX:34639061..34639099 No primer for this exon
downstream ENSMUSE00000624304 ChrX:34636853..34637013 AACGCCTGGGCAGAGTATAA ChrX:34636865..34636884 59.73 50
downstream ENSMUSE00000702092 ChrX:34635517..34635781 ATCATGCGCTCCTGATCTCT ChrX:34635724..34635743 59.94 50
downstream ENSMUSE00000708212 ChrX:34635517..34635817 ATCATGCGCTCCTGATCTCT ChrX:34635724..34635743 59.94 50
downstream ENSMUSE00000719003 ChrX:34635517..34635817 ATCATGCGCTCCTGATCTCT ChrX:34635724..34635743 59.94 50
downstream ENSMUSE00000315883 ChrX:34631829..34632656 TTTGTCCACTGGGGAATCTC ChrX:34632533..34632552 59.9 50
downstream ENSMUSE00000702082 ChrX:34631829..34632656 TTTGTCCACTGGGGAATCTC ChrX:34632533..34632552 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCACTTTGACCAAGGAA ChrX:34649209..34649229 60.08 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCCACTTTGACCAAGGAA ChrX:34649209..34649229 60.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036572