Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17577
Trapped Gene
Foxk1 (ENSMUSG00000056493)
Vector Insertion
Chr 5: 142926342 - 142927392
Public Clones not available
Private Clones OST440432 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000534632 (Chr5:142926195..142926341 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCCACCGTACTCCTATGC Chr5:142926204..142926223 59.22 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000534632 (Chr5:142926195..142926341 +)
Downstram Exon
ENSMUSE00000473425 (Chr5:142927393..142927586 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCCACCGTACTCCTATGC Chr5:142926204..142926223 59.22 55 CAGGGTCTATTCGCCAAAAA Chr5:142927495..142927514 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000590046 Chr5:142877451..142877995 GGAGTTCGAGTTCCTGATGC Chr5:142877771..142877790 59.81 55
upstream ENSMUSE00000474194 Chr5:142911095..142911280 TCCCCACTGAAGATCCACAT Chr5:142911201..142911220 60.33 50
upstream ENSMUSE00000590045 Chr5:142924641..142924797 CAGAATGTGACCTCCGACCT Chr5:142924702..142924721 60.11 55
upstream ENSMUSE00000534632 Chr5:142926195..142926341 AAGCCACCGTACTCCTATGC Chr5:142926204..142926223 59.22 55

*** Putative Vector Insertion (Chr 5: 142926342 - 142927392) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000473425 Chr5:142927393..142927586 CAGGGTCTATTCGCCAAAAA Chr5:142927495..142927514 60.07 45
downstream ENSMUSE00000472392 Chr5:142929463..142929629 TGGGAATAGCGGTACTCTGG Chr5:142929621..142929640 60.09 55
downstream ENSMUSE00000509938 Chr5:142929714..142929998 GATGTACCCGTTGGCTGAGT Chr5:142929922..142929941 60 55
downstream ENSMUSE00000590040 Chr5:142931307..142931531 GGTACAGCGTGCTTTCCATT Chr5:142931505..142931524 60.14 50
downstream ENSMUSE00000590039 Chr5:142932430..142937968 AGCAGGCCCTTCTAGTCCTC Chr5:142936831..142936850 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTACAGGACTGCCGACAAGG Chr5:142926315..142926335 60.84 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTACAGGACTGCCGACAAGG Chr5:142926315..142926335 60.84 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056493