Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17585
Trapped Gene
Mras (ENSMUSG00000032470)
Vector Insertion
Chr 9: 99290232 - 99293364
Public Clones not available
Private Clones OST440329 (lexicon) OST399771 (lexicon) OST351084 (lexicon) OST351083 (lexicon)
OST43267 (lexicon)
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000228388 (Chr9:99293365..99293464 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATTCCCAATGATCCTCGT Chr9:99293441..99293460 60.28 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000228388 (Chr9:99293365..99293464 -)
Downstram Exon
ENSMUSE00000228352 (Chr9:99290152..99290231 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATTCCCAATGATCCTCGT Chr9:99293441..99293460 60.28 45 GGTCCTTGGCACTGGTCTCT Chr9:99290179..99290198 61.65 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712608 Chr9:99337300..99337300 No primer for this exon
upstream ENSMUSE00000693576 Chr9:99336729..99336974 GAGAAGTCGCTCACCACTCC Chr9:99336809..99336828 59.99 60
upstream ENSMUSE00000721341 Chr9:99326196..99326315 CCAGGCCAGCAGTAAAGAGT Chr9:99326287..99326306 59.5 55
upstream ENSMUSE00000228435 Chr9:99311812..99312021 CTGACTACGACCCCACCATT Chr9:99311867..99311886 59.84 55
upstream ENSMUSE00000718499 Chr9:99311812..99312021 CTGACTACGACCCCACCATT Chr9:99311867..99311886 59.84 55
upstream ENSMUSE00000500642 Chr9:99294888..99295041 CTCATTCTGCGTGTCAAGGA Chr9:99294891..99294910 59.98 50
upstream ENSMUSE00000228388 Chr9:99293365..99293464 TCATTCCCAATGATCCTCGT Chr9:99293441..99293460 60.28 45

*** Putative Vector Insertion (Chr 9: 99290232 - 99293364) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000228352 Chr9:99290152..99290231 GGTCCTTGGCACTGGTCTCT Chr9:99290179..99290198 61.65 60
downstream ENSMUSE00000713723 Chr9:99288398..99288923 GTCTGGTGCGTTGTATGTGG Chr9:99288490..99288509 60.03 55
downstream ENSMUSE00000713352 Chr9:99288395..99288923 GTCTGGTGCGTTGTATGTGG Chr9:99288490..99288509 60.03 55
downstream ENSMUSE00000228311 Chr9:99287935..99288923 GTCTGGTGCGTTGTATGTGG Chr9:99288490..99288509 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCAGGGACCAAGGAAAAGA Chr9:99293382..99293402 60.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCAGGGACCAAGGAAAAGA Chr9:99293382..99293402 60.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032470