Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17586
Trapped Gene
Chchd5 (ENSMUSG00000037938)
Vector Insertion
Chr 2: 128956055 - 128956136
Public Clones not available
Private Clones OST440324 (lexicon) OST180313 (lexicon) OST40570 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000358210 (Chr2:128955914..128956054 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGTCGTGGCATCGAGATT Chr2:128955992..128956011 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000358210 (Chr2:128955914..128956054 +)
Downstram Exon
ENSMUSE00000396198 (Chr2:128956137..128956302 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGTCGTGGCATCGAGATT Chr2:128955992..128956011 59.83 50 TCCAGTTGTGGGTGAACTTG Chr2:128956302..128956321 59.56 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000263102 Chr2:128955545..128955593 CGGGTCTCTTCTCCCTGACT Chr2:128955547..128955566 60.78 60
upstream ENSMUSE00000358210 Chr2:128955914..128956054 AGAGTCGTGGCATCGAGATT Chr2:128955992..128956011 59.83 50

*** Putative Vector Insertion (Chr 2: 128956055 - 128956136) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000396198 Chr2:128956137..128956302 TCCAGTTGTGGGTGAACTTG Chr2:128956302..128956321 59.56 50
downstream ENSMUSE00000366170 Chr2:128959011..128959190 ATCAAGTGGGACGGTCAATC Chr2:128959087..128959106 59.79 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000037938