Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17598
Trapped Gene
Urm1 (ENSMUSG00000069020)
Vector Insertion
Chr 2: 29698290 - 29698622
Public Clones not available
Private Clones OST439827 (lexicon) OST432012 (lexicon) OST413312 (lexicon) OST352448 (lexicon)
OST271477 (lexicon) OST124786 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568260 (Chr2:29698241..29698289 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATTAATGATGCCGACTGG Chr2:29698261..29698280 59.5 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568260 (Chr2:29698241..29698289 +)
Downstram Exon
ENSMUSE00000568259 (Chr2:29698623..29699582 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATTAATGATGCCGACTGG Chr2:29698261..29698280 59.5 45 GAGTTGTAGGCAGCCTGGAG Chr2:29699372..29699391 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568263 Chr2:29682904..29682955 CGCCCTTATGTGTGAAGGTG Chr2:29682928..29682947 61.48 55
upstream ENSMUSE00000568262 Chr2:29688212..29688282 GCTCCTGTTTGATGGGGTAA Chr2:29688224..29688243 59.93 50
upstream ENSMUSE00000568261 Chr2:29696922..29697003 AGCGACCAGAGCTGTTCATC Chr2:29696970..29696989 60.56 55
upstream ENSMUSE00000568260 Chr2:29698241..29698289 TGATTAATGATGCCGACTGG Chr2:29698261..29698280 59.5 45

*** Putative Vector Insertion (Chr 2: 29698290 - 29698622) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568259 Chr2:29698623..29699582 GAGTTGTAGGCAGCCTGGAG Chr2:29699372..29699391 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGATTAATGATGCCGACTG Chr2:29698260..29698281 60.62 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069020