Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17602
Trapped Gene
Ucp3 (ENSMUSG00000032942)
Vector Insertion
Chr 7: 107621604 - 107627942
Public Clones not available
Private Clones OST439800 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000671975 (Chr7:107621502..107621603 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCCAACCTTGGCTAGACG Chr7:107621579..107621598 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000671975 (Chr7:107621502..107621603 +)
Downstram Exon
ENSMUSE00000671974 (Chr7:107627943..107628101 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCCAACCTTGGCTAGACG Chr7:107621579..107621598 60.12 55 GTGTCCAGGGGAAAAGTGAG Chr7:107628085..107628104 59.55 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000225926 Chr7:107621500..107621603 TACCCAACCTTGGCTAGACG Chr7:107621579..107621598 60.12 55
upstream ENSMUSE00000671975 Chr7:107621502..107621603 TACCCAACCTTGGCTAGACG Chr7:107621579..107621598 60.12 55

*** Putative Vector Insertion (Chr 7: 107621604 - 107627942) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000225915 Chr7:107627883..107628101 GAGGTCCGAGGAGAGAGCTT Chr7:107627940..107627959 60.1 60
downstream ENSMUSE00000671974 Chr7:107627943..107628101 GTGTCCAGGGGAAAAGTGAG Chr7:107628085..107628104 59.55 55
downstream ENSMUSE00000202247 Chr7:107628595..107628796 TTCGAATGGAGGCAAAACTC Chr7:107628748..107628767 60.19 45
downstream ENSMUSE00000202239 Chr7:107628990..107629190 AATCGGACCTTCACCACATC Chr7:107629086..107629105 59.79 50
downstream ENSMUSE00000225897 Chr7:107630380..107630481 CTTGTGATGTTGGGCCAAGT Chr7:107630404..107630423 60.95 50
downstream ENSMUSE00000225886 Chr7:107631084..107631264 GCGTTCATGTATCGGGTCTT Chr7:107631186..107631205 59.96 50
downstream ENSMUSE00000348151 Chr7:107633503..107634940 GTATAGGGCGCTCAAATGGA Chr7:107634867..107634886 60.06 50
downstream ENSMUSE00000671973 Chr7:107633503..107633815 GGACGAAACACGGAGGACTA Chr7:107633761..107633780 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGCTCTCTAAGCCATTCAG Chr7:107624624..107624644 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGCTAGACGCACAGGTAA Chr7:107624589..107624609 59.49 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032942