Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17605
Trapped Gene
Prdm9 (ENSMUSG00000051977)
Vector Insertion
Chr 17: 15699902 - 15700184
Public Clones not available
Private Clones OST439732 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000238429 (Chr17:15700185..15700295 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCATGAACACCAACAAGC Chr17:15700238..15700257 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000238429 (Chr17:15700185..15700295 -)
Downstram Exon
ENSMUSE00000238405 (Chr17:15699778..15699901 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCATGAACACCAACAAGC Chr17:15700238..15700257 60.01 50 CTGCCCATTCTTCTTTGGAG Chr17:15699825..15699844 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000238454 Chr17:15701200..15701304 GACCAGCGAGGCTTTCTAGG Chr17:15701208..15701227 61.41 60
upstream ENSMUSE00000238429 Chr17:15700185..15700295 CACCATGAACACCAACAAGC Chr17:15700238..15700257 60.01 50

*** Putative Vector Insertion (Chr 17: 15699902 - 15700184) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238405 Chr17:15699778..15699901 CTGCCCATTCTTCTTTGGAG Chr17:15699825..15699844 59.81 50
downstream ENSMUSE00000613663 Chr17:15699379..15699486 AAAGCTGGTCTAGGGGCTCT Chr17:15699440..15699459 59.48 55
downstream ENSMUSE00000613662 Chr17:15695987..15696036 No primer for this exon
downstream ENSMUSE00000613661 Chr17:15694511..15694538 No primer for this exon
downstream ENSMUSE00000238319 Chr17:15694265..15694421 TCCTTCTTCAAGGGAGGACA Chr17:15694277..15694296 59.77 50
downstream ENSMUSE00000238308 Chr17:15692530..15692631 CTTTCTCTCTCGCAGCCTGT Chr17:15692557..15692576 59.89 55
downstream ENSMUSE00000238295 Chr17:15692051..15692322 TTGGGACAACTGTCGATGAA Chr17:15692258..15692277 60.09 45
downstream ENSMUSE00000238540 Chr17:15691652..15691719 TCGTCCTGTCCATCCACATA Chr17:15691651..15691670 59.92 50
downstream ENSMUSE00000238524 Chr17:15690316..15690509 CAGTTCCTGGCCGTACTCAT Chr17:15690343..15690362 60.13 55
downstream ENSMUSE00000703518 Chr17:15682071..15682324 AGAAGGCCAAAGAGCACAAA Chr17:15682255..15682274 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGAGTGGAAACCCAAGGTA Chr17:15700180..15700200 60.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGAGTGGAAACCCAAGGTA Chr17:15700180..15700200 60.49 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051977