Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17611
Trapped Gene
March7 (ENSMUSG00000026977)
Vector Insertion
Chr 2: 60066974 - 60067140
Public Clones not available
Private Clones OST439692 (lexicon) OST404158 (lexicon) OST375302 (lexicon) OST352496 (lexicon)
OST297112 (lexicon) OST235486 (lexicon) OST232807 (lexicon) OST222326 (lexicon)
OST195386 (lexicon) OST167543 (lexicon) OST135195 (lexicon) OST131386 (lexicon)
OST101039 (lexicon) OST40180 (lexicon) OST40179 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711867 (Chr2:60066975..60067139 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTTCAACCCTCTGGCTCT Chr2:60067024..60067043 59.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711867 (Chr2:60066975..60067139 +)
Downstram Exon
ENSMUSE00000721679 (Chr2:60066975..60067139 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTTCAACCCTCTGGCTCT Chr2:60067024..60067043 59.45 55 AGCCAGAGGGTTGAACAGAA Chr2:60067044..60067063 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662485 Chr2:60047987..60048141 No primer for this exon
upstream ENSMUSE00000662481 Chr2:60048130..60048141 No primer for this exon
upstream ENSMUSE00000662480 Chr2:60062827..60062927 AGGGCTGCATCATTTATTGG Chr2:60062830..60062849 59.92 45

*** Putative Vector Insertion (Chr 2: 60066974 - 60067140) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711867 Chr2:60066975..60067139 AGCCAGAGGGTTGAACAGAA Chr2:60067044..60067063 59.84 50
downstream ENSMUSE00000719700 Chr2:60066975..60067139 AGCCAGAGGGTTGAACAGAA Chr2:60067044..60067063 59.84 50
downstream ENSMUSE00000721679 Chr2:60066975..60067139 AGCCAGAGGGTTGAACAGAA Chr2:60067044..60067063 59.84 50
downstream ENSMUSE00000566894 Chr2:60067741..60067936 CTCCCAGCTGAGGTAGATGC Chr2:60067907..60067926 59.97 60
downstream ENSMUSE00000692115 Chr2:60067741..60067936 CTCCCAGCTGAGGTAGATGC Chr2:60067907..60067926 59.97 60
downstream ENSMUSE00000566893 Chr2:60070257..60070424 No primer for this exon
downstream ENSMUSE00000692110 Chr2:60070257..60070424 No primer for this exon
downstream ENSMUSE00000566892 Chr2:60071956..60073054 AGAGGACGAGGAGGTTCCAT Chr2:60072446..60072465 60.07 55
downstream ENSMUSE00000692107 Chr2:60071956..60073054 AGAGGACGAGGAGGTTCCAT Chr2:60072446..60072465 60.07 55
downstream ENSMUSE00000566891 Chr2:60074811..60074983 CATTTGCACGGCTCTATCAA Chr2:60074918..60074937 59.83 45
downstream ENSMUSE00000566890 Chr2:60079000..60079109 No primer for this exon
downstream ENSMUSE00000566889 Chr2:60081614..60081727 GACACGAGTGCTTGGTTCAA Chr2:60081727..60081746 59.88 50
downstream ENSMUSE00000662483 Chr2:60083269..60083317 CCTGAAGAGTTCTTGCAAGGTT Chr2:60083297..60083318 59.92 45.46
downstream ENSMUSE00000692106 Chr2:60085545..60085569 No primer for this exon
downstream ENSMUSE00000662479 Chr2:60085947..60086030 No primer for this exon
downstream ENSMUSE00000662482 Chr2:60085947..60086014 No primer for this exon
downstream ENSMUSE00000692105 Chr2:60085947..60086014 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCATTTCACAGGAAACCTT Chr2:60066963..60066984 59.6 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTTCGTGACTGGGAAAACC Chr2:60067020..60067041 60.21 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026977