Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17623
Trapped Gene
Fbxl11 (ENSMUSG00000054611)
Vector Insertion
Chr 19: 4362915 - 4365156
Public Clones not available
Private Clones OST439530 (lexicon) OST415124 (lexicon) OST377254 (lexicon) OST371089 (lexicon)
OST319258 (lexicon) OST318812 (lexicon) OST301303 (lexicon) OST298158 (lexicon)
OST254053 (lexicon) OST240536 (lexicon) OST211150 (lexicon) OST184435 (lexicon)
OST183384 (lexicon) OST174794 (lexicon) OST171935 (lexicon) OST153417 (lexicon)
OST141114 (lexicon) OST73575 (lexicon) OST9654 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697123 (Chr19:4365157..4365180 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697123 (Chr19:4365157..4365180 -)
Downstram Exon
ENSMUSE00000492259 (Chr19:4362776..4362914 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGTTTGGAGCTTCTCTTCCA Chr19:4362797..4362816 59.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000707032 Chr19:4397934..4398266 TGCTACTGCTACCGGTTCCT Chr19:4398064..4398083 59.9 55
upstream ENSMUSE00000697145 Chr19:4396311..4397077 GACGCGGAGTCTGTAAAAGC Chr19:4396484..4396503 60.02 55
upstream ENSMUSE00000644473 Chr19:4394792..4394892 GGATTCGGTACAGCCAGAGA Chr19:4394795..4394814 60.22 55
upstream ENSMUSE00000697124 Chr19:4365785..4365802 No primer for this exon
upstream ENSMUSE00000697123 Chr19:4365157..4365180 No primer for this exon

*** Putative Vector Insertion (Chr 19: 4362915 - 4365156) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000492259 Chr19:4362776..4362914 GGTTTGGAGCTTCTCTTCCA Chr19:4362797..4362816 59.4 50
downstream ENSMUSE00000499673 Chr19:4361977..4362055 CACCCCGCTGGATATACTCT Chr19:4362004..4362023 59.03 55
downstream ENSMUSE00000504496 Chr19:4361538..4361584 No primer for this exon
downstream ENSMUSE00000505490 Chr19:4356748..4356926 CATTGTGCCATGGTCATTTC Chr19:4356835..4356854 59.78 45
downstream ENSMUSE00000247776 Chr19:4352268..4352374 GCCTTGGCCACATGTTATCTA Chr19:4352313..4352333 59.97 47.62
downstream ENSMUSE00000247754 Chr19:4351737..4351830 AGCAGCCTCGAACACTCATT Chr19:4351780..4351799 60.02 50
downstream ENSMUSE00000247736 Chr19:4350177..4350330 GAGCTCAATTCGTTGGCAAT Chr19:4350186..4350205 60.22 45
downstream ENSMUSE00000247717 Chr19:4348646..4348761 TTAATTGCATGGGGATGTTG Chr19:4348653..4348672 59.23 40
downstream ENSMUSE00000247648 Chr19:4345518..4345644 GGATCGGTTGGTTATGCAGT Chr19:4345536..4345555 59.82 50
downstream ENSMUSE00000393203 Chr19:4342847..4343241 CCTGTGGGGACACACTTCTT Chr19:4342862..4342881 60 55
downstream ENSMUSE00000247594 Chr19:4331186..4331269 GGATCGCTACTGGCAAGTTC Chr19:4331216..4331235 59.84 55
downstream ENSMUSE00000247451 Chr19:4328953..4329222 GCTAAGCACTGTCGGAGGAC Chr19:4328932..4328951 60.02 60
downstream ENSMUSE00000247425 Chr19:4328128..4328259 CAGATGCAGCATTCCATGAG Chr19:4328137..4328156 60.38 50
downstream ENSMUSE00000487092 Chr19:4326809..4326898 CTTTGTCCGAGCTGTCTTCC Chr19:4326792..4326811 59.99 55
downstream ENSMUSE00000405455 Chr19:4324337..4325046 AGTTCTTTGCGGCTGAGGTA Chr19:4324354..4324373 60.01 50
downstream ENSMUSE00000247321 Chr19:4322387..4322550 CTGAGGTCGAGGCTTACTGG Chr19:4322418..4322437 60.01 60
downstream ENSMUSE00000247290 Chr19:4320898..4321056 CGAAGATCAAGGGTCCTGAG Chr19:4320941..4320960 59.8 55
downstream ENSMUSE00000338144 Chr19:4320152..4320367 GGAAGACCCGACAGCAGTTA Chr19:4320164..4320183 60.26 55
downstream ENSMUSE00000707031 Chr19:4317822..4319281 GCAGGCAATAACCTTGGTGT Chr19:4318897..4318916 60 50
downstream ENSMUSE00000323076 Chr19:4316170..4319281 GCAGGCAATAACCTTGGTGT Chr19:4318897..4318916 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCGACTTGACCAAACTTTAAT Chr19:4365183..4365205 59.54 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCGACTTGACCAAACTTTAAT Chr19:4365183..4365205 59.54 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054611