Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17624
Trapped Gene
Slc7a7 (ENSMUSG00000000958)
Vector Insertion
Chr 14: 54994002 - 54994231
Public Clones not available
Private Clones OST439520 (lexicon) OST153244 (lexicon)
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000559616 (Chr14:54994232..54994355 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000559616 (Chr14:54994232..54994355 -)
Downstram Exon
ENSMUSE00000124130 (Chr14:54993898..54994001 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000323914 Chr14:55028087..55028297 No primer for this exon
upstream ENSMUSE00000124136 Chr14:55027340..55027885 No primer for this exon
upstream ENSMUSE00000124133 Chr14:54998784..54998909 No primer for this exon
upstream ENSMUSE00000124135 Chr14:54997450..54997594 No primer for this exon
upstream ENSMUSE00000559616 Chr14:54994232..54994355 No primer for this exon

*** Putative Vector Insertion (Chr 14: 54994002 - 54994231) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000124130 Chr14:54993898..54994001 No primer for this exon
downstream ENSMUSE00000124131 Chr14:54993526..54993622 No primer for this exon
downstream ENSMUSE00000124128 Chr14:54992624..54992773 No primer for this exon
downstream ENSMUSE00000124132 Chr14:54989777..54989960 No primer for this exon
downstream ENSMUSE00000388042 Chr14:54989128..54989570 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTTGCCGTGGTAAAGGAT Chr14:54994221..54994241 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTTGCCGTGGTAAAGGAT Chr14:54994221..54994241 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000958