Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17631
Trapped Gene
2310016E02Rik (ENSMUSG00000038803)
Vector Insertion
Chr 5: 31209140 - 31209771
Public Clones 5SE046B11 (ggtc) IST13602B9 (tigm)
Private Clones OST439344 (lexicon) OST439238 (lexicon) OST289779 (lexicon) OST202236 (lexicon)
OST68606 (lexicon) OST55048 (lexicon) OST50714 (lexicon) OST41147 (lexicon)
OST36713 (lexicon) OST20686 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273222 (Chr5:31209772..31210072 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGCAAGGAGTGCGTGAAT Chr5:31209939..31209958 60.02 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273222 (Chr5:31209772..31210072 -)
Downstram Exon
ENSMUSE00000273215 (Chr5:31208894..31209139 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGCAAGGAGTGCGTGAAT Chr5:31209939..31209958 60.02 50 TACTGGGCCCTATTCAGTGG Chr5:31208936..31208955 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000273222 Chr5:31209772..31210072 AGAGCAAGGAGTGCGTGAAT Chr5:31209939..31209958 60.02 50

*** Putative Vector Insertion (Chr 5: 31209140 - 31209771) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000273215 Chr5:31208894..31209139 TACTGGGCCCTATTCAGTGG Chr5:31208936..31208955 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGACAGCTGAGTGGTGAG Chr5:31209721..31209741 59.6 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGACAGCTGAGTGGTGAG Chr5:31209721..31209741 59.6 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038803