Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17633
Trapped Gene
Tyms (ENSMUSG00000025747)
Vector Insertion
Chr 5: 30398248 - 30399900
Public Clones IST11629D7 (tigm)
Private Clones OST439259 (lexicon) OST62979 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000276060 (Chr5:30399901..30400121 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTGCTCCGTTATGCTGGT Chr5:30400080..30400099 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000276060 (Chr5:30399901..30400121 -)
Downstram Exon
ENSMUSE00000152886 (Chr5:30398174..30398247 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTGCTCCGTTATGCTGGT Chr5:30400080..30400099 60.28 55 CTCGTTTGGTTGTGAGCAGA Chr5:30398196..30398215 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000276060 Chr5:30399901..30400121 GACTGCTCCGTTATGCTGGT Chr5:30400080..30400099 60.28 55

*** Putative Vector Insertion (Chr 5: 30398248 - 30399900) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000152886 Chr5:30398174..30398247 CTCGTTTGGTTGTGAGCAGA Chr5:30398196..30398215 60.03 50
downstream ENSMUSE00000152892 Chr5:30395006..30395180 GCCTCCATTGGAAACCATAA Chr5:30395017..30395036 59.76 45
downstream ENSMUSE00000152888 Chr5:30390625..30390726 TCCAGGCACACATGATGATT Chr5:30390612..30390631 59.92 45
downstream ENSMUSE00000152895 Chr5:30389776..30389951 GACAGTTCCCCATTCACCAC Chr5:30389860..30389879 60.22 55
downstream ENSMUSE00000152897 Chr5:30388508..30388579 GCATCTCCCAAAGTGTGGAC Chr5:30388526..30388545 60.52 55
downstream ENSMUSE00000363414 Chr5:30385367..30387673 TGAAGGACTTTGTGGGTTCC Chr5:30386733..30386752 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACGATACAGCCTGAGAGG Chr5:30399898..30399918 60.97 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACGATACAGCCTGAGAGG Chr5:30399898..30399918 60.97 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GACTGCTCCGTTATGCTGGT Chr5:30400078..30400098 60.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GACTGCTCCGTTATGCTGGT Chr5:30400078..30400098 60.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025747