Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17639
Trapped Gene
Wdr34 (ENSMUSG00000039715)
Vector Insertion
Chr 2: 29893694 - 29893947
Public Clones not available
Private Clones OST439184 (lexicon) OST438897 (lexicon) OST428429 (lexicon) OST417602 (lexicon)
OST321418 (lexicon) OST286097 (lexicon) OST241723 (lexicon) OST202281 (lexicon)
OST193757 (lexicon) OST192516 (lexicon) OST191982 (lexicon) OST187516 (lexicon)
OST177083 (lexicon) OST143779 (lexicon) OST129809 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696764 (Chr2:29893695..29893946 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696764 (Chr2:29893695..29893946 -)
Downstram Exon
ENSMUSE00000286799 (Chr2:29893695..29893946 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50 TCTGCCAGTTGTTGTTCAGC Chr2:29893723..29893742 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711889 Chr2:29904204..29904399 No primer for this exon
upstream ENSMUSE00000714590 Chr2:29904204..29904399 No primer for this exon
upstream ENSMUSE00000286799 Chr2:29893695..29893946 ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50
upstream ENSMUSE00000696764 Chr2:29893695..29893946 ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50

*** Putative Vector Insertion (Chr 2: 29893694 - 29893947) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000286790 Chr2:29890283..29890392 ACAGAGCCTGTCGAGTTCCA Chr2:29890282..29890301 61.01 55
downstream ENSMUSE00000286778 Chr2:29889326..29889483 CACCACTACTGATGGCTGCT Chr2:29889365..29889384 58.91 55
downstream ENSMUSE00000286767 Chr2:29888794..29888903 TGTCAGACCTGTACGCCAAA Chr2:29888802..29888821 60.3 50
downstream ENSMUSE00000286759 Chr2:29888270..29888437 AGAGCAACACCTTGCCATCT Chr2:29888337..29888356 59.87 50
downstream ENSMUSE00000286753 Chr2:29887922..29888154 ACGAAAAGGCTGGAGTCAAA Chr2:29888062..29888081 59.85 45
downstream ENSMUSE00000286744 Chr2:29887593..29887750 CAGTGAGGTAAGGGGCTGAG Chr2:29887650..29887669 59.86 60
downstream ENSMUSE00000337969 Chr2:29887159..29887492 TGATCCAAGTCCTCCACCTC Chr2:29887257..29887276 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAAAAGTTGCCAGACAGC Chr2:29893928..29893948 58.65 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAAAAGTTGCCAGACAGC Chr2:29893928..29893948 58.65 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039715