Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17648
Trapped Gene
Sumf2 (ENSMUSG00000025538)
Vector Insertion
Chr 5: 130334172 - 130335712
Public Clones not available
Private Clones OST439009 (lexicon)
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311153 (Chr5:130334116..130334171 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311153 (Chr5:130334116..130334171 +)
Downstram Exon
ENSMUSE00000311144 (Chr5:130335713..130335797 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTTGTCACCTTTGGGGAACT Chr5:130335739..130335758 59.42 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000592013 Chr5:130322872..130322962 ATGCGCTCTGAGTTCTGGTT Chr5:130322872..130322891 60.02 50
upstream ENSMUSE00000592012 Chr5:130325777..130325933 CCCTTTGCCATCGACATATT Chr5:130325890..130325909 59.78 45
upstream ENSMUSE00000504188 Chr5:130328750..130328861 GTGGAGCTTCGTCTTTGAGG Chr5:130328798..130328817 59.99 55
upstream ENSMUSE00000504952 Chr5:130329899..130329943 No primer for this exon
upstream ENSMUSE00000505982 Chr5:130330564..130330714 GCATCCGAGAGAAACTGGAG Chr5:130330583..130330602 59.95 55
upstream ENSMUSE00000311153 Chr5:130334116..130334171 No primer for this exon

*** Putative Vector Insertion (Chr 5: 130334172 - 130335712) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000311144 Chr5:130335713..130335797 TTTGTCACCTTTGGGGAACT Chr5:130335739..130335758 59.42 45
downstream ENSMUSE00000151506 Chr5:130335946..130336090 GGTTGGTATGTGGACGCTGT Chr5:130336003..130336022 60.84 55
downstream ENSMUSE00000378483 Chr5:130338515..130339928 TGCAGTCCGAGTGTTCTTTG Chr5:130338750..130338769 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCTCGTGACTGGGAAAAC Chr5:130334218..130334238 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025538