Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17649
Trapped Gene
Emp3 (ENSMUSG00000040212)
Vector Insertion
Chr 7: 53175408 - 53175658
Public Clones not available
Private Clones OST439008 (lexicon) OST237357 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000225683 (Chr7:53175659..53175774 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCATGTCACTCCTCCTGTT Chr7:53175720..53175739 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000225683 (Chr7:53175659..53175774 -)
Downstram Exon
ENSMUSE00000225674 (Chr7:53175305..53175407 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCATGTCACTCCTCCTGTT Chr7:53175720..53175739 60.12 55 GTTACTGCAGGCCCATGTTT Chr7:53175296..53175315 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000332025 Chr7:53176612..53176658 No primer for this exon
upstream ENSMUSE00000225683 Chr7:53175659..53175774 GCCATGTCACTCCTCCTGTT Chr7:53175720..53175739 60.12 55

*** Putative Vector Insertion (Chr 7: 53175408 - 53175658) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000225674 Chr7:53175305..53175407 GTTACTGCAGGCCCATGTTT Chr7:53175296..53175315 60 50
downstream ENSMUSE00000225665 Chr7:53174688..53174828 CGCATGGTGTAGAGTTGGAA Chr7:53174713..53174732 59.72 50
downstream ENSMUSE00000369132 Chr7:53173398..53173605 GATGTAGACAGTGCCGCTGA Chr7:53173435..53173454 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCACTTTGGACAAGGTAA Chr7:53175653..53175673 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCACTTTGGACAAGGTAA Chr7:53175653..53175673 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040212