Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17656
Trapped Gene
Cyp3a13 (ENSMUSG00000029727)
Vector Insertion
Chr 5: 138358799 - 138360226
Public Clones not available
Private Clones OST438833 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000535402 (Chr5:138360227..138360320 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTCTTGGGGACGATTCTTG Chr5:138360238..138360257 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000535402 (Chr5:138360227..138360320 -)
Downstram Exon
ENSMUSE00000192105 (Chr5:138358746..138358798 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTCTTGGGGACGATTCTTG Chr5:138360238..138360257 60.04 45 TGTATGTCACATTCCCAGAAGC Chr5:138358754..138358775 60 45.46

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497844 Chr5:138362670..138362847 GAAAGGTGCAGCACACAAAA Chr5:138362785..138362804 59.89 45
upstream ENSMUSE00000535402 Chr5:138360227..138360320 TTTCTTGGGGACGATTCTTG Chr5:138360238..138360257 60.04 45

*** Putative Vector Insertion (Chr 5: 138358799 - 138360226) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000192105 Chr5:138358746..138358798 TGTATGTCACATTCCCAGAAGC Chr5:138358754..138358775 60 45.46
downstream ENSMUSE00000535401 Chr5:138356802..138356901 GCCGGTTTGTGAAGGTAGAG Chr5:138356782..138356801 59.73 55
downstream ENSMUSE00000192109 Chr5:138353067..138353180 GGCTCGGATTCTCTTCCATT Chr5:138353084..138353103 60.55 50
downstream ENSMUSE00000192097 Chr5:138352767..138352855 CTGCCTCATGTTTCTCACCA Chr5:138352780..138352799 59.83 50
downstream ENSMUSE00000192102 Chr5:138351144..138351292 CTGTGGGTTGTTGAGGGAAT Chr5:138351192..138351211 59.82 50
downstream ENSMUSE00000192099 Chr5:138348662..138348789 TGCGATTCTCTTTCATTCGTT Chr5:138348657..138348677 59.84 38.1
downstream ENSMUSE00000192106 Chr5:138346758..138346824 No primer for this exon
downstream ENSMUSE00000192110 Chr5:138341477..138341637 AGAGCCGCATCAATTTCATC Chr5:138341465..138341484 60.19 45
downstream ENSMUSE00000535397 Chr5:138340026..138340252 GCCAGTACTTCGGGTCTTTG Chr5:138340032..138340051 59.73 55
downstream ENSMUSE00000535395 Chr5:138336411..138336573 AGAGCAAACCTCATGCCAAT Chr5:138336459..138336478 59.7 45
downstream ENSMUSE00000471988 Chr5:138335405..138335592 TGGTTTCTGGTCCACAGGAT Chr5:138335432..138335451 60.36 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGGACGATTCTTGCTTAC Chr5:138360231..138360251 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGGACGATTCTTGCTTAC Chr5:138360231..138360251 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029727