Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17665
Trapped Gene
Pcgf2 (ENSMUSG00000018537)
Vector Insertion
Chr 11: 97554729 - 97554883
Public Clones not available
Private Clones OST438598 (lexicon) OST368266 (lexicon) OST302779 (lexicon) OST288840 (lexicon)
OST259271 (lexicon) OST250653 (lexicon) OST200706 (lexicon) OST188553 (lexicon)
OST115536 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000285720 (Chr11:97554730..97554882 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000285720 (Chr11:97554730..97554882 -)
Downstram Exon
ENSMUSE00000715631 (Chr11:97554730..97554882 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000339180 Chr11:97561574..97561660 No primer for this exon
upstream ENSMUSE00000378146 Chr11:97560850..97560962 No primer for this exon
upstream ENSMUSE00000661403 Chr11:97560850..97560955 No primer for this exon
upstream ENSMUSE00000285742 Chr11:97560520..97560614 No primer for this exon
upstream ENSMUSE00000285732 Chr11:97559303..97559374 No primer for this exon
upstream ENSMUSE00000285720 Chr11:97554730..97554882 No primer for this exon
upstream ENSMUSE00000715631 Chr11:97554730..97554882 No primer for this exon

*** Putative Vector Insertion (Chr 11: 97554729 - 97554883) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111125 Chr11:97554040..97554136 No primer for this exon
downstream ENSMUSE00000111119 Chr11:97553818..97553873 No primer for this exon
downstream ENSMUSE00000111122 Chr11:97553683..97553733 No primer for this exon
downstream ENSMUSE00000673727 Chr11:97553683..97553721 No primer for this exon
downstream ENSMUSE00000111116 Chr11:97553359..97553449 No primer for this exon
downstream ENSMUSE00000661404 Chr11:97553341..97553449 No primer for this exon
downstream ENSMUSE00000111117 Chr11:97553172..97553226 No primer for this exon
downstream ENSMUSE00000111120 Chr11:97552998..97553093 No primer for this exon
downstream ENSMUSE00000673726 Chr11:97552998..97553036 No primer for this exon
downstream ENSMUSE00000111121 Chr11:97552275..97552355 No primer for this exon
downstream ENSMUSE00000673728 Chr11:97551139..97551672 No primer for this exon
downstream ENSMUSE00000399653 Chr11:97551134..97551672 No primer for this exon
downstream ENSMUSE00000673725 Chr11:97551106..97551672 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTAAGGGTGGCTGGATTT Chr11:97554904..97554924 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTAAGGGTGGCTGGATTT Chr11:97554904..97554924 60.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018537