Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17666
Trapped Gene
Ubl4 (ENSMUSG00000015290)
Vector Insertion
Chr X: 71613249 - 71613491
Public Clones not available
Private Clones OST438580 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000209215 (ChrX:71613492..71613597 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000209215 (ChrX:71613492..71613597 -)
Downstram Exon
ENSMUSE00000209216 (ChrX:71613040..71613248 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000374531 ChrX:71613755..71613866 No primer for this exon
upstream ENSMUSE00000209215 ChrX:71613492..71613597 No primer for this exon

*** Putative Vector Insertion (Chr X: 71613249 - 71613491) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209216 ChrX:71613040..71613248 No primer for this exon
downstream ENSMUSE00000623419 ChrX:71612741..71612925 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCATCCAGGGAGCTTTAC ChrX:71613455..71613475 60.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCATCCAGGGAGCTTTAC ChrX:71613455..71613475 60.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015290