Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17676
Trapped Gene
Relb (ENSMUSG00000002983)
Vector Insertion
Chr 7: 20205192 - 20206469
Public Clones IST10227F11 (tigm)
Private Clones OST438296 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636851 (Chr7:20206470..20206511 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636851 (Chr7:20206470..20206511 -)
Downstram Exon
ENSMUSE00000231745 (Chr7:20204863..20205191 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000536319 Chr7:20214540..20214787 No primer for this exon
upstream ENSMUSE00000599199 Chr7:20214540..20214726 No primer for this exon
upstream ENSMUSE00000536317 Chr7:20213272..20213319 No primer for this exon
upstream ENSMUSE00000636852 Chr7:20212505..20212506 No primer for this exon
upstream ENSMUSE00000676825 Chr7:20208275..20208283 No primer for this exon
upstream ENSMUSE00000636851 Chr7:20206470..20206511 No primer for this exon

*** Putative Vector Insertion (Chr 7: 20205192 - 20206469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000231745 Chr7:20204863..20205191 No primer for this exon
downstream ENSMUSE00000636850 Chr7:20204863..20205191 No primer for this exon
downstream ENSMUSE00000198388 Chr7:20203111..20203268 No primer for this exon
downstream ENSMUSE00000636848 Chr7:20203111..20203268 No primer for this exon
downstream ENSMUSE00000676824 Chr7:20203053..20203268 No primer for this exon
downstream ENSMUSE00000676823 Chr7:20202696..20202752 No primer for this exon
downstream ENSMUSE00000198389 Chr7:20201695..20201786 No primer for this exon
downstream ENSMUSE00000636846 Chr7:20201695..20201786 No primer for this exon
downstream ENSMUSE00000198390 Chr7:20200908..20201039 No primer for this exon
downstream ENSMUSE00000599197 Chr7:20200908..20201039 No primer for this exon
downstream ENSMUSE00000198387 Chr7:20199130..20199234 No primer for this exon
downstream ENSMUSE00000599196 Chr7:20199130..20199234 No primer for this exon
downstream ENSMUSE00000198394 Chr7:20197854..20198069 No primer for this exon
downstream ENSMUSE00000599195 Chr7:20197854..20198069 No primer for this exon
downstream ENSMUSE00000198392 Chr7:20197166..20197234 No primer for this exon
downstream ENSMUSE00000636843 Chr7:20197166..20197234 No primer for this exon
downstream ENSMUSE00000198391 Chr7:20196972..20197049 No primer for this exon
downstream ENSMUSE00000599193 Chr7:20196972..20197049 No primer for this exon
downstream ENSMUSE00000599192 Chr7:20191765..20192290 No primer for this exon
downstream ENSMUSE00000536308 Chr7:20191572..20192290 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAATCCCTTTGGCTGTGTG Chr7:20206436..20206456 59.97 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAATCCCTTTGGCTGTGTG Chr7:20206436..20206456 59.97 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGTTGGTATAATCGCCTTGC Chr7:20206449..20206469 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAACGGGTTGGTACGTGACT Chr7:20206454..20206474 59.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002983