Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17677
Trapped Gene
Praf2 (ENSMUSG00000031149)
Vector Insertion
Chr X: 7307060 - 7307393
Public Clones CMHD-GT_423F11-3 (cmhd) CMHD-GT_416A11-3 (cmhd) PSTVUpb14a6 (vanderbilt)
Private Clones OST438282 (lexicon) OST428961 (lexicon) OST252820 (lexicon) OST15962 (lexicon)
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000206888 (ChrX:7306842..7307059 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTGCCATTAGCCTCTTCA ChrX:7306980..7306999 60.49 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000206888 (ChrX:7306842..7307059 +)
Downstram Exon
ENSMUSE00000242962 (ChrX:7307394..7308184 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTGCCATTAGCCTCTTCA ChrX:7306980..7306999 60.49 50 GGCTAGGAAAAGGGTTGGTC ChrX:7307606..7307625 59.94 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000206889 ChrX:7305697..7305888 GATCCACAACGATGGTGTCA ChrX:7305794..7305813 60.39 50
upstream ENSMUSE00000206888 ChrX:7306842..7307059 GCTTGCCATTAGCCTCTTCA ChrX:7306980..7306999 60.49 50

*** Putative Vector Insertion (Chr X: 7307060 - 7307393) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000242962 ChrX:7307394..7308184 GGCTAGGAAAAGGGTTGGTC ChrX:7307606..7307625 59.94 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTCTCGACTCTCCCTGCT ChrX:7307063..7307083 58.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031149