Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17680
Trapped Gene
Ahi1 (ENSMUSG00000019986)
Vector Insertion
Chr 10: 20672559 - 20679417
Public Clones not available
Private Clones OST438254 (lexicon) OST338033 (lexicon) OST32482 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666567 (Chr10:20672465..20672558 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666567 (Chr10:20672465..20672558 +)
Downstram Exon
ENSMUSE00000615723 (Chr10:20679418..20679886 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666567 Chr10:20672465..20672558 No primer for this exon

*** Putative Vector Insertion (Chr 10: 20672559 - 20679417) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000615723 Chr10:20679418..20679886 No primer for this exon
downstream ENSMUSE00000705462 Chr10:20679490..20679886 No primer for this exon
downstream ENSMUSE00000615722 Chr10:20682871..20683040 No primer for this exon
downstream ENSMUSE00000615721 Chr10:20683479..20683698 No primer for this exon
downstream ENSMUSE00000615720 Chr10:20685323..20685515 No primer for this exon
downstream ENSMUSE00000615719 Chr10:20685732..20685827 No primer for this exon
downstream ENSMUSE00000615718 Chr10:20688794..20688979 No primer for this exon
downstream ENSMUSE00000615717 Chr10:20690655..20690807 No primer for this exon
downstream ENSMUSE00000615716 Chr10:20691830..20691962 No primer for this exon
downstream ENSMUSE00000615715 Chr10:20696803..20696926 No primer for this exon
downstream ENSMUSE00000615714 Chr10:20699186..20699415 No primer for this exon
downstream ENSMUSE00000615713 Chr10:20701130..20701236 No primer for this exon
downstream ENSMUSE00000615712 Chr10:20704111..20704229 No primer for this exon
downstream ENSMUSE00000422994 Chr10:20706776..20706906 No primer for this exon
downstream ENSMUSE00000422987 Chr10:20708350..20708490 No primer for this exon
downstream ENSMUSE00000615709 Chr10:20720312..20720511 No primer for this exon
downstream ENSMUSE00000422977 Chr10:20727558..20727584 No primer for this exon
downstream ENSMUSE00000422970 Chr10:20737719..20737839 No primer for this exon
downstream ENSMUSE00000422966 Chr10:20760992..20761047 No primer for this exon
downstream ENSMUSE00000422963 Chr10:20774787..20774949 No primer for this exon
downstream ENSMUSE00000422958 Chr10:20777959..20778056 No primer for this exon
downstream ENSMUSE00000666565 Chr10:20790094..20790349 No primer for this exon
downstream ENSMUSE00000379790 Chr10:20792349..20792407 No primer for this exon
downstream ENSMUSE00000705461 Chr10:20792349..20792407 No primer for this exon
downstream ENSMUSE00000402886 Chr10:20794181..20794283 No primer for this exon
downstream ENSMUSE00000705460 Chr10:20794181..20794283 No primer for this exon
downstream ENSMUSE00000666566 Chr10:20798890..20800234 No primer for this exon
downstream ENSMUSE00000705463 Chr10:20798890..20799027 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr10:20672610..20672630 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTCCCTCCTCTCTGTGA Chr10:20672544..20672564 60.55 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019986