Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17685
Trapped Gene
Acad11 (ENSMUSG00000032558)
Vector Insertion
Chr 9: 103992666 - 103993921
Public Clones not available
Private Clones OST438190 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000316854 (Chr9:103992588..103992665 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAACTCAGCGGAAAAGTGG Chr9:103992616..103992635 59.85 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000316854 (Chr9:103992588..103992665 +)
Downstram Exon
ENSMUSE00000316839 (Chr9:103993922..103994060 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAACTCAGCGGAAAAGTGG Chr9:103992616..103992635 59.85 50 TCACAGCTGGCAAGAACAAA Chr9:103993973..103993992 60.57 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000334057 Chr9:103904934..103905491 GTGCCCGAGCTAGAGTATGC Chr9:103905339..103905358 60.01 60
upstream ENSMUSE00000717491 Chr9:103904984..103905131 CCACGCTCCTCTCTGATTTT Chr9:103904986..103905005 59.43 50
upstream ENSMUSE00000387048 Chr9:103907044..103907169 AGGGTGCGTTAGAAGCAAAA Chr9:103907084..103907103 59.88 45
upstream ENSMUSE00000338334 Chr9:103907786..103907936 GCGAGAGTTGGAGAGCAAAC Chr9:103907836..103907855 60.14 55
upstream ENSMUSE00000411803 Chr9:103910451..103910603 ACCCTTTGCAAACATCAACC Chr9:103910581..103910600 59.84 45
upstream ENSMUSE00000371387 Chr9:103911470..103911603 GATGAAACACAGCCCGAAAT Chr9:103911568..103911587 59.94 45
upstream ENSMUSE00000317944 Chr9:103913931..103914091 ATGTGCGAGACAATGGGATA Chr9:103913955..103913974 58.95 45
upstream ENSMUSE00000220795 Chr9:103917655..103917811 TCCAACCTAGGCAAGACCAC Chr9:103917782..103917801 60.11 55
upstream ENSMUSE00000220789 Chr9:103918410..103918484 ACGTGGGTGTGGAAAAGATT Chr9:103918456..103918475 59.31 45
upstream ENSMUSE00000220805 Chr9:103920433..103920606 CTCGAGAACACAGACGTGGA Chr9:103920445..103920464 60.02 55
upstream ENSMUSE00000220793 Chr9:103923056..103923159 GGACCAGGTTCTGGGAAGTC Chr9:103923122..103923141 60.89 60
upstream ENSMUSE00000432448 Chr9:103923586..103923700 GTGGGGAGACCAATGTCAAC Chr9:103923638..103923657 60.22 55
upstream ENSMUSE00000220788 Chr9:103924992..103925135 CCTGCTAAGCTTCTGGAGGA Chr9:103925034..103925053 59.71 55
upstream ENSMUSE00000409117 Chr9:103925750..103925847 TCTGTGAACGTGGAGACCTG Chr9:103925813..103925832 59.86 55
upstream ENSMUSE00000367063 Chr9:103926912..103927014 TGGCCTACACTGCATCTTGA Chr9:103926916..103926935 60.41 50
upstream ENSMUSE00000410174 Chr9:103928232..103928314 TGTCACCCTTTTCAGCAAGA Chr9:103928285..103928304 59.42 45
upstream ENSMUSE00000347484 Chr9:103932292..103932430 AACGTAGCTGAAACCCTCCA Chr9:103932308..103932327 59.73 50
upstream ENSMUSE00000220808 Chr9:103934221..103934385 CACAATGGCGTGAGTGAGTC Chr9:103934245..103934264 60.32 55
upstream ENSMUSE00000220807 Chr9:103935658..103935752 No primer for this exon
upstream ENSMUSE00000220806 Chr9:103936708..103936830 CACAGTTGCCTCCTCAACCT Chr9:103936784..103936803 60.3 55
upstream ENSMUSE00000220787 Chr9:103938036..103938222 GGCGACCGAGTACTTTGAGT Chr9:103938096..103938115 59.36 55
upstream ENSMUSE00000220792 Chr9:103938369..103938610 CTGGCGACTCTGTACCACAA Chr9:103938582..103938601 59.9 55
upstream ENSMUSE00000220811 Chr9:103939662..103939737 No primer for this exon
upstream ENSMUSE00000220800 Chr9:103940765..103940892 GTTGGAAGAGCTCACCTTGG Chr9:103940800..103940819 59.84 55
upstream ENSMUSE00000220810 Chr9:103941664..103941904 GTTTCTGAAGCGTTCCTTGG Chr9:103941676..103941695 59.85 50
upstream ENSMUSE00000220804 Chr9:103942952..103943077 CTTGGCAGTCCTTCATAGCC Chr9:103943053..103943072 59.84 55
upstream ENSMUSE00000432512 Chr9:103942994..103943077 CTTGGCAGTCCTTCATAGCC Chr9:103943053..103943072 59.84 55
upstream ENSMUSE00000220797 Chr9:103943469..103943584 ATGCATCCTCGAGTTGGAGA Chr9:103943538..103943557 60.77 50
upstream ENSMUSE00000357172 Chr9:103944282..103945877 TGAGGAGTGGCTTGGTCTCT Chr9:103944688..103944707 59.99 55
upstream ENSMUSE00000706749 Chr9:103944282..103945035 TGAGGAGTGGCTTGGTCTCT Chr9:103944688..103944707 59.99 55
upstream ENSMUSE00000714051 Chr9:103944282..103945439 TGAGGAGTGGCTTGGTCTCT Chr9:103944688..103944707 59.99 55
upstream ENSMUSE00000713036 Chr9:103965707..103965850 AGAGTCACGTTTGCGACCTT Chr9:103965790..103965809 59.91 50
upstream ENSMUSE00000346614 Chr9:103966033..103966233 TGACACCGTGGAAGTGCTAC Chr9:103966111..103966130 59.75 55
upstream ENSMUSE00000317136 Chr9:103975952..103976051 CAGGACAGTCAAACCCAACC Chr9:103975954..103975973 60.4 55
upstream ENSMUSE00000721717 Chr9:103975952..103976051 CAGGACAGTCAAACCCAACC Chr9:103975954..103975973 60.4 55
upstream ENSMUSE00000707980 Chr9:103978147..103978272 TCCATTGGATTTCCTGTTGC Chr9:103978183..103978202 60.84 45
upstream ENSMUSE00000714949 Chr9:103978147..103978272 TCCATTGGATTTCCTGTTGC Chr9:103978183..103978202 60.84 45
upstream ENSMUSE00000317054 Chr9:103978660..103978821 GAGTCGGGTACTGCAAAAGG Chr9:103978799..103978818 59.73 55
upstream ENSMUSE00000692445 Chr9:103978660..103978821 GAGTCGGGTACTGCAAAAGG Chr9:103978799..103978818 59.73 55
upstream ENSMUSE00000354160 Chr9:103980893..103981057 GAAGCAGTACCAGGCCTCAG Chr9:103980907..103980926 60.01 60
upstream ENSMUSE00000692441 Chr9:103980893..103981057 GAAGCAGTACCAGGCCTCAG Chr9:103980907..103980926 60.01 60
upstream ENSMUSE00000316998 Chr9:103983561..103983702 TGACGGACTTAGCCCATCTT Chr9:103983613..103983632 59.69 50
upstream ENSMUSE00000692437 Chr9:103983561..103983702 TGACGGACTTAGCCCATCTT Chr9:103983613..103983632 59.69 50
upstream ENSMUSE00000358952 Chr9:103984028..103984149 TCAATATACTGCCACCGAAGG Chr9:103984054..103984074 59.97 47.62
upstream ENSMUSE00000692435 Chr9:103984028..103984149 TCAATATACTGCCACCGAAGG Chr9:103984054..103984074 59.97 47.62
upstream ENSMUSE00000401594 Chr9:103985121..103985227 TGCCAATACTGTGCAACCTC Chr9:103985177..103985196 59.72 50
upstream ENSMUSE00000692434 Chr9:103985121..103985227 TGCCAATACTGTGCAACCTC Chr9:103985177..103985196 59.72 50
upstream ENSMUSE00000386438 Chr9:103986491..103986617 GGAGAGGCCAGGAAGTTCTC Chr9:103986550..103986569 60.34 60
upstream ENSMUSE00000692433 Chr9:103986491..103986617 GGAGAGGCCAGGAAGTTCTC Chr9:103986550..103986569 60.34 60
upstream ENSMUSE00000316854 Chr9:103992588..103992665 GAAACTCAGCGGAAAAGTGG Chr9:103992616..103992635 59.85 50
upstream ENSMUSE00000692432 Chr9:103992588..103992665 GAAACTCAGCGGAAAAGTGG Chr9:103992616..103992635 59.85 50

*** Putative Vector Insertion (Chr 9: 103992666 - 103993921) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000316839 Chr9:103993922..103994060 TCACAGCTGGCAAGAACAAA Chr9:103993973..103993992 60.57 45
downstream ENSMUSE00000692431 Chr9:103993922..103994060 TCACAGCTGGCAAGAACAAA Chr9:103993973..103993992 60.57 45
downstream ENSMUSE00000316824 Chr9:103997851..103997958 GCTGCCATACAGGTGCAGTA Chr9:103997891..103997910 59.9 55
downstream ENSMUSE00000692430 Chr9:103997851..103997958 GCTGCCATACAGGTGCAGTA Chr9:103997891..103997910 59.9 55
downstream ENSMUSE00000316812 Chr9:103999684..103999782 CCTCCATCTCTCTGGATGGT Chr9:103999747..103999766 59.05 55
downstream ENSMUSE00000692428 Chr9:103999684..103999782 CCTCCATCTCTCTGGATGGT Chr9:103999747..103999766 59.05 55
downstream ENSMUSE00000316799 Chr9:104015792..104015858 GAGGGAGACTCCGTTCTTCC Chr9:104015852..104015871 60.19 60
downstream ENSMUSE00000692425 Chr9:104015792..104015858 GAGGGAGACTCCGTTCTTCC Chr9:104015852..104015871 60.19 60
downstream ENSMUSE00000316783 Chr9:104016783..104016868 ACTCCACTCCAGGTGTGTCC Chr9:104016838..104016857 60.01 60
downstream ENSMUSE00000692423 Chr9:104016783..104016868 ACTCCACTCCAGGTGTGTCC Chr9:104016838..104016857 60.01 60
downstream ENSMUSE00000316764 Chr9:104017608..104017679 TTGAAATGGACCTCCCAGTG Chr9:104017647..104017666 60.89 50
downstream ENSMUSE00000692420 Chr9:104017608..104017679 TTGAAATGGACCTCCCAGTG Chr9:104017647..104017666 60.89 50
downstream ENSMUSE00000316743 Chr9:104018495..104018649 TGGATTCTTCCAGGTCCAAG Chr9:104018552..104018571 60.04 50
downstream ENSMUSE00000692419 Chr9:104018495..104018649 TGGATTCTTCCAGGTCCAAG Chr9:104018552..104018571 60.04 50
downstream ENSMUSE00000316721 Chr9:104025377..104025493 TCGATGGCTATACGGCTCTT Chr9:104025423..104025442 59.83 50
downstream ENSMUSE00000692418 Chr9:104025377..104025493 TCGATGGCTATACGGCTCTT Chr9:104025423..104025442 59.83 50
downstream ENSMUSE00000316689 Chr9:104026348..104026457 GATGGCCCAGTCAGCTATTT Chr9:104026410..104026429 59.15 50
downstream ENSMUSE00000692416 Chr9:104026348..104026457 GATGGCCCAGTCAGCTATTT Chr9:104026410..104026429 59.15 50
downstream ENSMUSE00000350136 Chr9:104028912..104029976 GAGAGGTGGACTTCGTCAGG Chr9:104028971..104028990 59.83 60
downstream ENSMUSE00000692413 Chr9:104028912..104029976 GAGAGGTGGACTTCGTCAGG Chr9:104028971..104028990 59.83 60
downstream ENSMUSE00000719537 Chr9:104028912..104029793 GAGAGGTGGACTTCGTCAGG Chr9:104028971..104028990 59.83 60
downstream ENSMUSE00000706748 Chr9:104055800..104055813 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGAAGGCACTCAACATGG Chr9:103992677..103992697 59.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGAAGGCACTCAACATGG Chr9:103992677..103992697 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032558