Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17687
Trapped Gene
Msra (ENSMUSG00000054733)
Vector Insertion
Chr 14: 64829372 - 64852665
Public Clones IST12888H1 (tigm)
Private Clones OST438182 (lexicon) OST286391 (lexicon)
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000424002 (Chr14:64852666..64852770 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGTCGTCCGGGTTGTGTA Chr14:64852734..64852753 60.95 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000424002 (Chr14:64852666..64852770 -)
Downstram Exon
ENSMUSE00000423996 (Chr14:64829265..64829371 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGTCGTCCGGGTTGTGTA Chr14:64852734..64852753 60.95 55 GACTGCTGACCGGTACTGTG Chr14:64829303..64829322 59.34 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000557621 Chr14:65074719..65074740 No primer for this exon
upstream ENSMUSE00000557620 Chr14:65073596..65073730 CCAAGGCTGGAATGACTTCT Chr14:65073641..65073660 59.28 50
upstream ENSMUSE00000557619 Chr14:65072299..65072400 CACCGTTTGAAGAAGTGCTG Chr14:65072375..65072394 59.49 50
upstream ENSMUSE00000557617 Chr14:65071234..65071312 AGATTAGCAAGGTCGGATGG Chr14:65071270..65071289 59.15 50
upstream ENSMUSE00000557616 Chr14:65069801..65069875 GCTCAGCTTCGAGATCTTCCT Chr14:65069818..65069838 60.25 52.38
upstream ENSMUSE00000424013 Chr14:65059547..65059863 GCGACTCAGCTTCGAAAGTC Chr14:65059599..65059618 60.28 55
upstream ENSMUSE00000497089 Chr14:64932524..64932592 ATGTCAGTGGCAACAGAACG Chr14:64932564..64932583 59.75 50
upstream ENSMUSE00000424024 Chr14:64903901..64904020 ACACACGCAATCCCACCTAC Chr14:64903917..64903936 60.84 55
upstream ENSMUSE00000424002 Chr14:64852666..64852770 GAAGTCGTCCGGGTTGTGTA Chr14:64852734..64852753 60.95 55

*** Putative Vector Insertion (Chr 14: 64829372 - 64852665) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000423996 Chr14:64829265..64829371 GACTGCTGACCGGTACTGTG Chr14:64829303..64829322 59.34 60
downstream ENSMUSE00000423991 Chr14:64741466..64742190 ACACTTGTCCCTCTCGGATG Chr14:64742111..64742130 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGAGAAGCTGGGCTTGAGA Chr14:64831672..64831692 59.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAGAAGCTGGGCTTGAGA Chr14:64831672..64831692 59.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGCAGGAAACAAAGGGAAG Chr14:64831775..64831795 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGTCGTCCGGGTTGTGTACC Chr14:64831730..64831750 62.18 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054733