Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17702
Trapped Gene
1700061G19Rik (ENSMUSG00000024209)
Vector Insertion
Chr 17: 57024647 - 57025863
Public Clones IST10904F3 (tigm) IST13124A7 (tigm) IST11996H11 (tigm) IST12685G12 (tigm)
IST14857G12 (tigm) IST12685G12 (tigm)
Private Clones OST437793 (lexicon) OST205118 (lexicon) OST180331 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139761 (Chr17:57024507..57024646 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAAATGGTCAACCCGTAT Chr17:57024528..57024547 60.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139761 (Chr17:57024507..57024646 +)
Downstram Exon
ENSMUSE00000283440 (Chr17:57025864..57026110 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAAATGGTCAACCCGTAT Chr17:57024528..57024547 60.81 50 AGGTTACTCCGAGCCTCTCC Chr17:57025907..57025926 59.84 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000284015 Chr17:57014906..57015103 TGATAAAGTGGCAGCCTGTG Chr17:57015009..57015028 59.86 50
upstream ENSMUSE00000283990 Chr17:57015511..57015819 CTGTGGACACCTGGTCCTCT Chr17:57015611..57015630 60.15 60
upstream ENSMUSE00000283969 Chr17:57016786..57017012 GCAACTGCTCACCTACATCG Chr17:57016949..57016968 59.47 55
upstream ENSMUSE00000376498 Chr17:57019874..57019962 GTCTGGAACGCTTTCATGGT Chr17:57019878..57019897 60.12 50
upstream ENSMUSE00000283885 Chr17:57020369..57020489 TCGCTGAGACCTCAGAAATG Chr17:57020422..57020441 59.11 50
upstream ENSMUSE00000493939 Chr17:57021590..57021670 TCCAGGGCTACTTGAAGCAT Chr17:57021591..57021610 59.84 50
upstream ENSMUSE00000283830 Chr17:57021964..57022113 ACTGAAGCCCAATCAGTGCT Chr17:57022029..57022048 59.87 50
upstream ENSMUSE00000139757 Chr17:57022203..57022409 GCTACCTGCCACTTTGCTTC Chr17:57022279..57022298 60.02 55
upstream ENSMUSE00000139751 Chr17:57022739..57022920 TCCACACCAACAAGAAGCTG Chr17:57022893..57022912 59.87 50
upstream ENSMUSE00000283755 Chr17:57023050..57023283 GTTGTACGGCTTGTCGGAGT Chr17:57023215..57023234 60.18 55
upstream ENSMUSE00000139749 Chr17:57024174..57024391 GGGCTTCTTGGATTTTGACA Chr17:57024342..57024361 60.05 45
upstream ENSMUSE00000139761 Chr17:57024507..57024646 GGGAAATGGTCAACCCGTAT Chr17:57024528..57024547 60.81 50

*** Putative Vector Insertion (Chr 17: 57024647 - 57025863) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000283440 Chr17:57025864..57026110 AGGTTACTCCGAGCCTCTCC Chr17:57025907..57025926 59.84 60
downstream ENSMUSE00000693744 Chr17:57028060..57028327 GGCGCTTGAACGAAGATTAG Chr17:57028182..57028201 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTAATCGCCTTGCAGCAC Chr17:57024695..57024715 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACGGAGCAAGACTCTGACC Chr17:57024653..57024673 61.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024209