Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17706
Trapped Gene
Arv1 (ENSMUSG00000031982)
Vector Insertion
Chr 8: 127246243 - 127249155
Public Clones (sanger) IST13571D2 (tigm)
Private Clones OST437687 (lexicon) OST274450 (lexicon) OST155145 (lexicon) OST91097 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000215441 (Chr8:127246039..127246242 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCGTGCTCAAGATAACCAT Chr8:127246219..127246238 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000215441 (Chr8:127246039..127246242 +)
Downstram Exon
ENSMUSE00000282407 (Chr8:127249156..127249275 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCGTGCTCAAGATAACCAT Chr8:127246219..127246238 60.1 50 TGCCTGTAGGCCTGAGTTTT Chr8:127249253..127249272 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000215441 Chr8:127246039..127246242 GGCGTGCTCAAGATAACCAT Chr8:127246219..127246238 60.1 50

*** Putative Vector Insertion (Chr 8: 127246243 - 127249155) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000282407 Chr8:127249156..127249275 TGCCTGTAGGCCTGAGTTTT Chr8:127249253..127249272 59.88 50
downstream ENSMUSE00000282379 Chr8:127252229..127252382 CGCAGGTATGCTTCACAAAG Chr8:127252281..127252300 59.49 50
downstream ENSMUSE00000282345 Chr8:127254692..127254916 TAGCTGGACAGCAACAGTGC Chr8:127254809..127254828 60.21 55
downstream ENSMUSE00000215444 Chr8:127255697..127255841 AGCCACTTAGCACGACCAAC Chr8:127255750..127255769 60.32 55
downstream ENSMUSE00000215439 Chr8:127257707..127258023 GCGTTCAGCCTTGGTATAGG Chr8:127257844..127257863 59.73 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGAACTTGTAATCGCCTTG Chr8:127246285..127246305 60.63 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTTGCGTGACTGGGAAAA Chr8:127246288..127246308 60.67 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031982