Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17714
Trapped Gene
Dnajc17 (ENSMUSG00000034278)
Vector Insertion
Chr 2: 119011824 - 119012081
Public Clones not available
Private Clones OST437582 (lexicon) OST334839 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307752 (Chr2:119012082..119012151 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAAGGCGTACAGGCAAAA Chr2:119012129..119012148 59.88 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307752 (Chr2:119012082..119012151 -)
Downstram Exon
ENSMUSE00000307747 (Chr2:119011765..119011823 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAAGGCGTACAGGCAAAA Chr2:119012129..119012148 59.88 45 GGACAGCTGGTGGAAGAGTT Chr2:119011779..119011798 59.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000307758 Chr2:119034424..119034510 ACTAGAACCATGGCGGTGAC Chr2:119034491..119034510 60 55
upstream ENSMUSE00000307752 Chr2:119012082..119012151 AAGAAGGCGTACAGGCAAAA Chr2:119012129..119012148 59.88 45

*** Putative Vector Insertion (Chr 2: 119011824 - 119012081) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307747 Chr2:119011765..119011823 GGACAGCTGGTGGAAGAGTT Chr2:119011779..119011798 59.31 55
downstream ENSMUSE00000307739 Chr2:119011432..119011519 CGTCAAGTCTCTGGGTCCTC Chr2:119011434..119011453 59.83 60
downstream ENSMUSE00000307729 Chr2:119009653..119009738 GCTCCTGCTCTCCTCCTCTT Chr2:119009652..119009671 60.24 60
downstream ENSMUSE00000307719 Chr2:119009335..119009431 ACTGACGGGAACCCTCTTCT Chr2:119009376..119009395 60.11 55
downstream ENSMUSE00000307708 Chr2:119006662..119006705 GGGTTCCTTTGCCTTCAGTA Chr2:119006651..119006670 59.17 50
downstream ENSMUSE00000307697 Chr2:119006223..119006300 CTCTGGAGTAGCCACCTTGG Chr2:119006227..119006246 59.86 60
downstream ENSMUSE00000307689 Chr2:119005621..119005701 CATTGCCTGCCTTCTTTCTG Chr2:119005631..119005650 60.9 50
downstream ENSMUSE00000307679 Chr2:119005088..119005198 CTCCAACCAGGAAACCTTCA Chr2:119005114..119005133 60.08 50
downstream ENSMUSE00000384836 Chr2:118998243..118998421 TCCCTTTCTGACAGCACTGA Chr2:118998377..118998396 59.54 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCAGATAACCCCAGAGCAG Chr2:119012080..119012100 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAGATAACCCCAGAGCAG Chr2:119012080..119012100 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034278